ID: 1107068440

View in Genome Browser
Species Human (GRCh38)
Location 13:36243137-36243159
Sequence AGGTTTGGGCAGAGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107068440_1107068448 0 Left 1107068440 13:36243137-36243159 CCCTACTCCCTCTGCCCAAACCT 0: 1
1: 0
2: 0
3: 44
4: 465
Right 1107068448 13:36243160-36243182 GGTTCCTAGCCTTCCCCCACAGG 0: 1
1: 0
2: 0
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107068440 Original CRISPR AGGTTTGGGCAGAGGGAGTA GGG (reversed) Intronic
900139297 1:1132812-1132834 AGGTTAGGGCAGAGGGACACGGG - Intergenic
900546257 1:3230896-3230918 AGGTGTGAGCAAAGGGAGCAGGG + Intronic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
901868257 1:12122058-12122080 AGGTGGGGGCAGAGTGAGTGAGG + Intronic
902218088 1:14947274-14947296 AGGGTGGGGAAGAGGGAGGATGG + Intronic
902249433 1:15144294-15144316 ACGTTTGGGGAGATGGAGGATGG - Intergenic
903765135 1:25729182-25729204 AGGTTTCGGGGGAGGGAATAAGG - Intronic
904009629 1:27382424-27382446 AGGTTTGGGGAGAGGGGCCAGGG + Intronic
904015521 1:27417256-27417278 GGGTTTGGGCAGAGGGGTTGTGG - Intronic
904485629 1:30823064-30823086 AGGTTGGGGGAGAGGGAATACGG - Intergenic
904964416 1:34360564-34360586 AGACTTGGGCAGGGGCAGTAAGG + Intergenic
906021647 1:42634577-42634599 AGGTTTGGCTAGTGGTAGTATGG + Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906942018 1:50263838-50263860 AGGTGTGGGGAGAGGGAGACAGG - Intergenic
908381691 1:63602957-63602979 TGGTTCCAGCAGAGGGAGTAGGG + Intronic
908487099 1:64605626-64605648 AGGCTTGGGCAGACTGAGTGGGG + Intronic
909642486 1:77884127-77884149 AGGTTTAGGCAGGGGTGGTAAGG - Intergenic
909922567 1:81400515-81400537 AGGTTTGGGCCTGGGGAGTAGGG + Intronic
910066733 1:83162458-83162480 AGGTTTACTCAGAGGGAGAAAGG - Intergenic
910294164 1:85627983-85628005 AGGACTGGGTAGAGGGAGTGGGG - Intergenic
910898639 1:92095369-92095391 AGGGTTGGTCAGAAGGAGCAAGG - Intronic
912118080 1:106432594-106432616 AGTTTTAAGCAGAGTGAGTAAGG + Intergenic
912665610 1:111576829-111576851 AGCTTTAGGAAGCGGGAGTATGG + Intronic
912881152 1:113415800-113415822 AGCTATTGGGAGAGGGAGTAAGG - Intronic
912953749 1:114138066-114138088 AGGAGGGGGCAGAGGGAGTGTGG + Intronic
912956440 1:114156897-114156919 AGGCTGGGGCAAAGGGAGGAGGG + Intergenic
914385151 1:147161748-147161770 ATGGTTGGGCTCAGGGAGTAAGG + Exonic
914991196 1:152501027-152501049 ATTTTTGGGAAGAGGGAGGAAGG - Intergenic
915041114 1:152969066-152969088 AGGCTTGGGAAGAGGAAGTGGGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915117503 1:153609932-153609954 GGGTTTGGGCAGGCGGAGGAGGG - Intronic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915622790 1:157096151-157096173 AGCTTAGCTCAGAGGGAGTAGGG - Intronic
916861083 1:168806334-168806356 AGGTTTGGGGTGAGGGAGTGGGG - Intergenic
917591465 1:176480754-176480776 AGGGGTGGGGAGAGGGAGAAGGG - Intronic
918085893 1:181245011-181245033 AGAGTTGGGATGAGGGAGTAGGG - Intergenic
918581444 1:186135593-186135615 AGATTTGTGGATAGGGAGTAAGG - Intronic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919792254 1:201299828-201299850 TGGTTTGGAAAGAGGGAGTTGGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920298918 1:204976630-204976652 AGGGTTGGGAGGAGGGGGTAGGG - Intronic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
921286347 1:213613066-213613088 ATGGTTGGGGAGAGGGAGTTGGG - Intergenic
921317992 1:213909936-213909958 AGGTCTGGGCAGAAGAGGTAAGG + Intergenic
921455554 1:215366435-215366457 AGGTTTGGGAATAAGTAGTATGG - Intergenic
923052673 1:230399661-230399683 AGGAATGTGCAGTGGGAGTAGGG + Intronic
924502075 1:244647199-244647221 AGGATGGGGCATGGGGAGTAGGG + Intergenic
1063390264 10:5645708-5645730 AAGTTTGGGCAAAGGGACTGGGG + Intronic
1063390392 10:5646364-5646386 AAGTTTGGGCAAAGGGACTGGGG + Intronic
1064087581 10:12356793-12356815 AGATTTGGGAAGTGGGAGTTTGG + Intronic
1064088291 10:12362245-12362267 AGGTCAGGGAGGAGGGAGTAGGG - Intronic
1066187711 10:33026520-33026542 AGGTCTGGCCTGAGGCAGTAGGG - Intergenic
1067222666 10:44355318-44355340 AGGTCTGGGCTGAGACAGTAGGG + Intergenic
1070548538 10:77472942-77472964 AGGATTGGGCAGGGTGAGTTTGG + Intronic
1070838606 10:79467808-79467830 AGGTTGGGGCAGAGAAAGGAAGG - Intergenic
1070848857 10:79546365-79546387 AGGTTTGGGAGGAGGAGGTAAGG - Intergenic
1070924933 10:80213825-80213847 AGGTTTGGGAGGAGGAGGTAAGG + Intergenic
1071338302 10:84620281-84620303 AGGTTTGGGGACAGGTAGTGAGG - Intergenic
1071381547 10:85068161-85068183 AGGTTTGAGGAGAGGGAGAGAGG - Intergenic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1073141225 10:101249264-101249286 TGGGTTGGGCAGAGGCTGTAAGG + Intergenic
1073308372 10:102521314-102521336 ATGTATGGGCAGAGGTAGAATGG - Intronic
1074400541 10:113138151-113138173 AGTTGAGGTCAGAGGGAGTAAGG + Intronic
1074894472 10:117763012-117763034 AGGATTGGGGAGAGGGTGAAAGG + Intergenic
1075187808 10:120278523-120278545 AGATTTGGCCTCAGGGAGTAAGG + Intergenic
1077007496 11:365184-365206 TGGTTTGGGCAGAGGCATTGAGG - Intergenic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1077410314 11:2400801-2400823 AGGTTTGTGGTGAGGGAGGACGG + Intronic
1078048933 11:7945262-7945284 AGGTTTGGGCCCAGGCAGCATGG + Intergenic
1078176436 11:8974960-8974982 TGGGTTGGGAAGAGGGAGTATGG - Intergenic
1078760144 11:14245184-14245206 AGGATAGGGCAGTGGGAGTGAGG + Intronic
1079434925 11:20438265-20438287 AGGTTTGGGCTGGGGGAGCAGGG + Intronic
1081558025 11:44185159-44185181 GGTTTTGGGCACAGGAAGTAAGG - Intronic
1081589147 11:44408853-44408875 AGGAGTGGGCAGAGGGAATGTGG + Intergenic
1081636726 11:44726880-44726902 AGGTTTGGGGAGGGGGAGGGAGG + Intronic
1081986082 11:47305482-47305504 AGGTTTGGGCCTAGGGAGCAGGG + Intronic
1081990579 11:47335260-47335282 AGGAGTGGGCAGTGGGAGTGGGG - Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083601652 11:63952405-63952427 AGGTATGAGCAGAGCGAGTGGGG + Exonic
1083962307 11:66021184-66021206 AGCTGTGGGCAGAAGGAGTGGGG + Exonic
1083998592 11:66284081-66284103 AGGTTGGGGCAGATGGAGACAGG - Exonic
1084488211 11:69463476-69463498 AGATTTTGGGAGAGGGAGGAAGG - Intergenic
1084617579 11:70246644-70246666 AAGTTTTGCAAGAGGGAGTAAGG - Intergenic
1084688288 11:70710187-70710209 AGGTGTGGGGAGAGCCAGTAGGG - Intronic
1084771747 11:71347434-71347456 TGGCTTGGGCAGAGGGTGTCAGG + Intergenic
1085340455 11:75727924-75727946 AGGTATGGGGTGAGGGAGCAGGG - Intronic
1085745629 11:79112008-79112030 AGGTGGGGGCAGAGAGAGGAAGG + Intronic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1089644488 11:119869660-119869682 AGGTCTAGGCAGAGAGAGGATGG - Intergenic
1089976425 11:122735937-122735959 AGGTTTAAGCAGAGGTAATATGG + Intronic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1092111896 12:5970132-5970154 AGATTTGGCCACAGGGAGTCAGG - Intronic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1094823109 12:34242814-34242836 AGGTTTTGGCAGTGAGAGTTTGG + Intergenic
1095091569 12:38112261-38112283 AGGTTTTGGCAGTGAGAGTTTGG - Intergenic
1095162307 12:38932860-38932882 AGGTTTTGGAAGAAGGCGTAGGG + Intergenic
1095361098 12:41340441-41340463 AGGTTGGGGGTGAGGAAGTAGGG + Intronic
1095812301 12:46383653-46383675 GGGTTCGGGGAGAGGGAGGAGGG + Intergenic
1096193517 12:49634605-49634627 AGGCCTGGGCAGAGGGAGCCAGG + Intronic
1096353967 12:50924558-50924580 GGGTTTGGGCGGGGGAAGTAAGG + Intronic
1096843964 12:54395355-54395377 AGGGTTGGGCAGAGAGATGAGGG + Exonic
1097180125 12:57167052-57167074 AGGGATGGGCAGAGGGAGTCAGG + Intronic
1097471390 12:59997459-59997481 AGGCCTGAGGAGAGGGAGTATGG - Intergenic
1098465759 12:70784081-70784103 AGCTGAGGGCAGAGGGAGCAGGG + Intronic
1098560325 12:71865372-71865394 AGGTTTGGGCCTGGGGAGCAGGG + Intronic
1098863460 12:75735451-75735473 AGTTTTGGACCCAGGGAGTATGG - Intergenic
1100744782 12:97633755-97633777 TGGTGAGGGCAGAGGGAGTAAGG + Intergenic
1100747221 12:97659559-97659581 AGGTTAGGGCAAAGGTAGAAGGG + Intergenic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1101304910 12:103518739-103518761 AGGTTTGGACAGAAGAAATACGG - Intergenic
1102221098 12:111194962-111194984 AGGGTTGGGGAGAGGGAGATGGG - Intronic
1102720418 12:115011299-115011321 ACGTCGGGGCAGAGGGTGTATGG - Intergenic
1104537182 12:129629063-129629085 AGTCTTGGGTAGAGGGAGAAAGG - Intronic
1104660695 12:130609759-130609781 AGGTCTGGGAAGTGGGGGTAGGG + Intronic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1105522972 13:21147970-21147992 GGGTTTGGGTAGAGGTAGAAAGG + Exonic
1106384962 13:29275496-29275518 GGGTGGGAGCAGAGGGAGTAGGG - Intronic
1106775477 13:33004325-33004347 ATGTTTAGGCAGAGGGATAAGGG + Intergenic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1107118591 13:36774174-36774196 AGGTATGGGAAGAAGGAGAAAGG + Intergenic
1107308386 13:39048155-39048177 GGGGTTGGGAAGAGGGACTAAGG + Exonic
1108103395 13:46982686-46982708 GGGTTTGGGGATAGGGAGGAAGG - Intergenic
1112220815 13:97487962-97487984 AGTTTGGAGCAGAGAGAGTAAGG - Intergenic
1112454391 13:99545469-99545491 AGGTTTGGACAGAGGGTGGTAGG + Intronic
1114233511 14:20804173-20804195 AGGTGGGGGCTGGGGGAGTAAGG - Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1114645019 14:24250819-24250841 AGGTTTAGGCAAAGGCAGGAAGG - Intronic
1114957610 14:27844141-27844163 AGGTGAGGGGAGAGGAAGTAGGG - Intergenic
1115160399 14:30387351-30387373 AGGTGTGGGTAGAGGAAGAAAGG + Intergenic
1117727039 14:58684715-58684737 GGGGTTGGGGAGAGGGAGAATGG - Intergenic
1118986719 14:70761915-70761937 AGGTTTGGGAGGAGGGAGAATGG - Intronic
1119740750 14:77012348-77012370 AGGATGAGGCAGAGGGAGAAAGG - Intergenic
1120081033 14:80216465-80216487 AGGTTTGGGCAGTGGGGAGAGGG - Intronic
1121109255 14:91301377-91301399 AGGTTTTGGCAGGTGGAGTCTGG - Intronic
1121213292 14:92226009-92226031 AGGTGCTGGCAGAGGGAGTTGGG - Intergenic
1121258945 14:92552533-92552555 AGGTGAGAGCAGAGGGGGTAGGG - Intronic
1121600577 14:95200151-95200173 AGTTCTGGGTAGAGGGACTAAGG - Intronic
1122834881 14:104425721-104425743 AGGTTGGGGCAGTGGGGGCAGGG - Intergenic
1123072144 14:105647117-105647139 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123092153 14:105746635-105746657 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123178457 14:106444091-106444113 ACATTTGGTCAGAGGGAGTCTGG + Intergenic
1124907855 15:33888346-33888368 AGGTTGGGGCAGAGTCAGTGAGG + Intronic
1126717449 15:51534319-51534341 AGATTTGGCCTGAGGTAGTAAGG + Intronic
1128096614 15:64961051-64961073 AGGTTTGGGCAGTGGGGCCATGG + Intergenic
1128684167 15:69671443-69671465 TGGTTGGGGCTGAGGGAGCAAGG - Intergenic
1128867274 15:71123739-71123761 AGGTTGGGGGAGAGGGAAGAGGG + Intronic
1128894915 15:71364131-71364153 AGGTTTGGCCAGTGGAAGTGGGG + Intronic
1129357145 15:74998767-74998789 AGGTTAGGGCAGAGAGAATCTGG - Intronic
1129450320 15:75647837-75647859 AGGGGTGGGGAGAGGGAGGAGGG - Intronic
1129460347 15:75697275-75697297 AGGATGGGGCAGAGGGAAGAGGG - Intronic
1129677916 15:77642379-77642401 TGGTGTGGGGAGAGGGAGAAAGG + Intronic
1129834897 15:78696186-78696208 AGTGTTGGCCAGAGGGACTATGG + Intronic
1130239607 15:82174725-82174747 AGGGTTTGGCAGTGGGACTAAGG - Intronic
1130555357 15:84918678-84918700 AGGTTTGGGCTCTGGGAGCAAGG - Intronic
1130754897 15:86752768-86752790 AGGTTTGGTCACAGAGAGTTTGG - Intronic
1132037693 15:98500652-98500674 AGGTTTGGGCCTGGGGAGCAAGG + Intronic
1132174320 15:99697939-99697961 GGTTTTTGGCAGAGGTAGTAAGG + Intronic
1132566143 16:624298-624320 AGGTTGGGGCACAGGGACTGGGG - Intronic
1133203262 16:4217621-4217643 AGTTGTGTGCAGAGGGAGTAAGG - Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133643537 16:7741032-7741054 GGGATGGGGCAGAGGGAGGAGGG - Intergenic
1133978840 16:10619038-10619060 AGGCCTTGGCAGAGGGAGGAGGG + Intergenic
1134222111 16:12362996-12363018 AGACTTGGGCAGAGGGAGCATGG - Intronic
1134323365 16:13184158-13184180 TGGTTTGGGAAGAGGCAGGATGG + Intronic
1134692107 16:16197735-16197757 AGGCTGGGGCAGAGGGAGAGGGG + Intronic
1134756252 16:16670181-16670203 AGGATAGGACAGAGGGAGCACGG - Intergenic
1134989818 16:18688983-18689005 AGGATAGGACAGAGGGAGCACGG + Intergenic
1136230617 16:28883314-28883336 GAGCTTGGGCAGAGGGAGTGAGG + Intronic
1136296901 16:29309002-29309024 AGGGATGGGCAGAGGGAGCACGG - Intergenic
1136370151 16:29831085-29831107 AGGGTGGGGCATAGGGAGTGAGG - Intronic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1136568013 16:31081437-31081459 AGTTTGGGACAGAGGGAGCACGG - Exonic
1136683015 16:31978820-31978842 AGGTTTGGGGAGAGGAAGCCAGG + Intergenic
1137384994 16:48033212-48033234 AGGGTTAGGCAGAGAGAGAAAGG + Intergenic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1137795434 16:51213750-51213772 AGGTTTGGGCAGCTGGAGTGTGG - Intergenic
1139130437 16:64136253-64136275 GGGTTTGAACAGAGGAAGTAGGG + Intergenic
1139963257 16:70730031-70730053 TGGTTTGGGCAGCGGGTGGATGG - Intronic
1140159689 16:72475772-72475794 AGGTTGGGGATGAGGGAGTTTGG - Intergenic
1140786490 16:78347264-78347286 AGCATTGGCCAGAGGGAGAAAGG - Intronic
1141925202 16:87163903-87163925 AGATTTGGGAAGTGGGAGAAAGG + Intronic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142058476 16:88015189-88015211 AGGGATGGGCAGAAGGAGCACGG - Intronic
1142979099 17:3661377-3661399 AGCTTTGGGCAGAGGGAAGGAGG - Exonic
1143118610 17:4594050-4594072 AGGTCTGAGCAGGGGGAGTGAGG + Intronic
1143195845 17:5075853-5075875 AGTTTTGAGCAGAGTGAGGAAGG + Intergenic
1143784036 17:9243696-9243718 AGGAGGGGGCAGAGGGAGGAGGG - Exonic
1144100891 17:11941337-11941359 AGGTTGGGACAGAGGGAGAGAGG - Intronic
1144159028 17:12538889-12538911 AGGTTTGAGCAGAGAGGGTAGGG + Intergenic
1146822746 17:35997894-35997916 AGGTGTGGGCAGATGGAGACAGG + Intronic
1147041100 17:37719674-37719696 GGGTCTGGGCAAAGGGAGAAAGG + Intronic
1147137575 17:38443186-38443208 AGGCTTGGGGACAGGGAGGATGG - Intronic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1147862442 17:43531418-43531440 AGGCAAGGGCAGAGGAAGTAGGG - Intronic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148804443 17:50257250-50257272 TGGTGTGGGCAGATGGAGAAGGG + Intergenic
1149630363 17:58116817-58116839 AGGTCTGGGGAGATGGAGCATGG - Intergenic
1149684539 17:58527820-58527842 GGCTCTGGGCAGAGGGGGTAAGG - Intronic
1150847280 17:68672283-68672305 AGGTTTGGGAACAGGGAATAAGG + Intergenic
1151699645 17:75736492-75736514 AGGTTTGGGGAGCGGGGGTCTGG + Intronic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152034181 17:77861890-77861912 AGGTGTGGGCAGAGACACTAGGG - Intergenic
1152268367 17:79309428-79309450 TGGGTGGGGCAGAGGGAGCAAGG - Intronic
1152301027 17:79495435-79495457 AGGTGTGGGGAGAGGGAGAGGGG + Intronic
1152437161 17:80283494-80283516 TGTTGTGGGCAGAGGGAGTGAGG + Intronic
1153434000 18:5049129-5049151 AAGTTTGGGCACAGAGAGGAGGG - Intergenic
1153481918 18:5555578-5555600 AGGGTTTGGGAGAGAGAGTAAGG - Intronic
1153530266 18:6039022-6039044 GGGTTGGGGAAGAGGGAGGAAGG - Intronic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1154484787 18:14865063-14865085 AAGTGTGGCCAGAGGGAGTGGGG - Intergenic
1156258463 18:35422336-35422358 AGGTTTGGGCCTGGGGAGAAGGG + Intergenic
1156541761 18:37918991-37919013 AGGCAGGGGTAGAGGGAGTAGGG + Intergenic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1157391084 18:47303938-47303960 AGGGATGGGCAGAGGAAGAATGG + Intergenic
1157520350 18:48341256-48341278 AGATGTGGGCAGAGGAAGGAAGG + Intronic
1159408017 18:68031557-68031579 AGGGTTGGGGAGAGCAAGTATGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162937996 19:13991284-13991306 AAGGTGGGGCAGAGGGAGAATGG + Intronic
1165010693 19:32844118-32844140 GGGTTTTGGCAGAGTGAGTGAGG + Intronic
1165309641 19:35022489-35022511 AGGTATGGGCAGAGGGGTTGGGG + Intronic
1165743430 19:38217032-38217054 AGGGTTTGGGAGAGGCAGTAGGG - Intronic
1166675622 19:44738953-44738975 GGGTTTGGGCTGACGGAGAAAGG - Intergenic
1166801848 19:45462740-45462762 AGGTTTGGCCAGAGGAAGGTGGG + Intronic
1167208415 19:48117847-48117869 AGGGCTGGGGAGAGGGAGGAAGG + Intronic
1167573959 19:50308888-50308910 AGGATGGGGCAGAGAGAGTCAGG + Intronic
1167681395 19:50923996-50924018 AGGTTTGGACACAGGGACTCTGG + Intergenic
1168063007 19:53904576-53904598 AGGTTTGGGGAAAGGCAGTTGGG + Intronic
1168137432 19:54360760-54360782 AGGTGTGTGCAGAGGAAGAAGGG + Intronic
1168160645 19:54508322-54508344 AGGTGTGTGCAGAGGAAGAAGGG - Intronic
1168349823 19:55669378-55669400 AGGCTTGAGCAGAGGGAGACTGG + Intronic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925531416 2:4867330-4867352 AGGTTGAGGGAGAGGGTGTAGGG + Intergenic
926726747 2:16004594-16004616 AGGTGGGGGCAGAGGGGATAGGG - Intergenic
928087515 2:28355290-28355312 GGGTGTGGGCAGAGGGAATGGGG - Intergenic
928254021 2:29706418-29706440 GGTTGTGGGCAGAGGGGGTAGGG - Intronic
929342524 2:40838614-40838636 AGGTCTAGGCAGAGGGATGAGGG - Intergenic
930113512 2:47698962-47698984 AGGTATGGGCTCAGGAAGTAGGG - Intronic
930253388 2:49061006-49061028 AGGTATGGGCAGGGGGAGAAAGG - Intronic
931400278 2:61925138-61925160 AGGTTTGGGGAAAGGGAGATTGG + Intronic
931585413 2:63821302-63821324 AGATTTGGGGTGAGGAAGTAGGG + Intronic
932108599 2:68972225-68972247 AGGTTGGGGGAGAGGGAGTGTGG - Intergenic
934049785 2:88200432-88200454 CGGCTTGGGCAGAGGAAGTGCGG - Intergenic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
936061613 2:109298651-109298673 AGGCCTGGCCAGAGGGAGCACGG - Intronic
936245216 2:110820539-110820561 AGGTCTGAGGAGAGGGAGTGGGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936597455 2:113862378-113862400 AGATTTTGGCTGAGGGAGTGGGG - Intergenic
936679817 2:114757220-114757242 AGGGTGGGGAAGAGGGAGGAAGG + Intronic
936905986 2:117536261-117536283 AGGTTTGGGCCTGGGGAGCAGGG + Intergenic
936976000 2:118223545-118223567 AGGTTTGGGAAGAGGGAGCGTGG - Intergenic
937247314 2:120502018-120502040 AGAGTAGGGCAGAAGGAGTAGGG - Intergenic
937583454 2:123517073-123517095 AGCTTTGGGCACAAGGAGAAAGG + Intergenic
938954721 2:136287218-136287240 AGGTATGTGTATAGGGAGTAGGG - Intergenic
940223462 2:151377873-151377895 AGGTTTGAGCACAGGCAGTCTGG - Intronic
941635779 2:167933590-167933612 AGACCTGGGCAGACGGAGTAAGG + Intergenic
942779111 2:179620049-179620071 AGGTTTAGGCAAAAGGAGAAAGG - Intronic
942897812 2:181079204-181079226 AGATTTGGGCATAGGGTGTATGG + Intergenic
943330785 2:186556389-186556411 AGGGTGGGGCAGAGGGAGGGAGG - Intergenic
943475880 2:188354304-188354326 AAGTTTGGACCTAGGGAGTAGGG - Intronic
947087791 2:226475134-226475156 AGGATTGGGCAGAGAGATAAGGG - Intergenic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
948149292 2:235732581-235732603 AGGCTTGGGGAGAGGAAGGAGGG - Intronic
1169632021 20:7644469-7644491 AGGTTGGGGAAGATGGAGAAAGG + Intergenic
1170300564 20:14880215-14880237 AGTTTTGGGGAGAGGGAGCATGG + Intronic
1170749314 20:19131154-19131176 TGGGTTGGGGAGAGGGAGTGGGG - Intergenic
1170835219 20:19878216-19878238 AGCTTTGGGCATTGGGAGCATGG - Intergenic
1171086214 20:22240336-22240358 AGCAGTGGGCAGAGGGAGAATGG - Intergenic
1171291878 20:23987044-23987066 AGGTATGGGCAGAGTGGTTAGGG + Intronic
1172485859 20:35297575-35297597 AGGATTGGACAGAGGGAGAGGGG - Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1173115660 20:40240580-40240602 AGGGGTGGGCTGAGGGAATATGG - Intergenic
1173834422 20:46115937-46115959 AGGTTGGGGCTGAGTGAGGAAGG + Intergenic
1173932241 20:46830443-46830465 TGGCAGGGGCAGAGGGAGTATGG - Intergenic
1174335992 20:49861132-49861154 AGATTTGGGGAGAGGAGGTAAGG + Intronic
1175213272 20:57375159-57375181 TGGTTTGGGCAGGGGGAGTTAGG + Intronic
1176365068 21:6027794-6027816 GGGTTGGGGCTGAGGGAGGAAGG + Intergenic
1176796538 21:13374412-13374434 AAGTGTGGCCAGAGGGAGTGGGG + Intergenic
1176873748 21:14105281-14105303 AGGTTTTGGCAGTGAGAGTTTGG + Intergenic
1178470155 21:32885343-32885365 TGCTTTAGGAAGAGGGAGTAGGG - Intergenic
1178513403 21:33226442-33226464 AGGTTGGGGTGGAGGGGGTAGGG + Intergenic
1178526265 21:33331798-33331820 AGGTTTGGGCCTGGGGAGCAGGG - Intronic
1178682964 21:34688682-34688704 AGGCTTGGGCAGAGGGTGCAGGG + Intronic
1179008641 21:37535848-37535870 AGGTTTGCGCAGAGGGCAGATGG + Intergenic
1179168810 21:38956959-38956981 TGGCTTGGGCTGAGGGAGGAAGG - Intergenic
1179758450 21:43510751-43510773 GGGTTGGGGCTGAGGGAGGAAGG - Intergenic
1180091226 21:45534706-45534728 AGGCTGAGGAAGAGGGAGTAGGG - Intronic
1180205256 21:46255773-46255795 AGGTCTGGGCTGAGGGGGCAGGG + Intronic
1180304694 22:11065189-11065211 AAGTTTGGCCAGAGGAAGTGGGG - Intergenic
1180667789 22:17528421-17528443 AGGGTTGGGGAGAGGTAGGATGG + Intronic
1181463050 22:23096571-23096593 AGGTGGGGGCAGAGGGAACAGGG + Intronic
1181514893 22:23404772-23404794 AGGTCTGTGCAGTGGGAGCAAGG + Intergenic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182768574 22:32776675-32776697 AGGGTAGTGCAGAGGGAGCATGG - Intronic
1182990560 22:34763561-34763583 AGGTTGGGGCAGAGAGACCAGGG - Intergenic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183448921 22:37879781-37879803 AGCTTTGTGCAGTGGCAGTATGG - Intronic
1183648148 22:39138590-39138612 GGGGTTGGGCAGGGGGAGAAAGG + Intronic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
1184092704 22:42300825-42300847 AGGTCTTGGCAGGGGGAGGAGGG - Intronic
1184453424 22:44596213-44596235 AAGTCGGGGCAGAGGGGGTAGGG + Intergenic
1184460543 22:44635294-44635316 AGGTTGGGGGAGAGGGGGCATGG + Intergenic
1185130817 22:49037592-49037614 AGGATTGGGGAGCGGGAGGAGGG + Intergenic
1185346970 22:50314699-50314721 AGCTGTGGGCAGAGGCAGCAGGG + Exonic
950536967 3:13584395-13584417 AGGTCTGGGCAGAGAGAGCCTGG - Intronic
950568929 3:13788097-13788119 AGCTGGGGGCTGAGGGAGTAAGG - Intergenic
950715699 3:14846268-14846290 AGGATGGGGCTGAGGGAGGAGGG + Intronic
950955008 3:17043320-17043342 AGGCTTGAGTAGAGGGAGAATGG + Intronic
951420320 3:22476051-22476073 AGGATTGGACAGAGGAAGTTGGG - Intergenic
952970009 3:38644848-38644870 GGGTTGGAGCAGAGGGAATAGGG - Intronic
953203757 3:40801586-40801608 GGGTATGGGCAGAGGAAGGAAGG + Intergenic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954211147 3:49098158-49098180 AGGTTTGGGGTGAGGGAGGTAGG - Intronic
955039244 3:55298868-55298890 AGGTTTGGGGAGTGGGACTTGGG + Intergenic
955231020 3:57098729-57098751 AAGTTTTTGCAGAGGGACTAGGG - Intronic
955773386 3:62408223-62408245 AGGATTAGGGTGAGGGAGTAGGG + Intronic
955777189 3:62446401-62446423 AGTTTTGTGGGGAGGGAGTATGG + Intronic
955936033 3:64103503-64103525 AGGTCAGGGCAGTGGGAGGAGGG + Intronic
956788324 3:72661092-72661114 AGGATGGGGCAGAAGGAGGAGGG + Intergenic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
958002429 3:87767496-87767518 AGGTTGGGACAGCGGGAGAAGGG - Intergenic
958824802 3:99017471-99017493 AAGCTTGGGCAGAGAGAGAAGGG - Intergenic
958859160 3:99424404-99424426 AGGTTGGGGAAAAGGGAGTCTGG - Intergenic
960648221 3:119914281-119914303 TGGTTTGGTCAGATGGAGTTTGG - Intronic
961814928 3:129544516-129544538 AGGTATGGGCAGTGGGGGCATGG + Intronic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962010208 3:131384215-131384237 AAGTTTGGGCAGAGGGAACCAGG + Intronic
962029507 3:131584435-131584457 AGGCTTGGATATAGGGAGTAAGG - Intronic
962182033 3:133216591-133216613 GGGCTTGGGGAGAGGGAGTTGGG - Intronic
963020103 3:140864531-140864553 AGGTTTGGGAAGAGGCATGATGG - Intergenic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
963606153 3:147413111-147413133 AGGTCTGGGAAGAGGGAGACTGG - Intronic
963821497 3:149899713-149899735 AGGATTTGGTATAGGGAGTAAGG + Intronic
964074853 3:152681366-152681388 GGAGTTGGGCAGAGAGAGTAAGG - Intergenic
964721695 3:159773408-159773430 AGGCTTGGGCTGAGGAAGTTAGG - Intronic
964832807 3:160904430-160904452 ATTTTTGGACAGAGGGATTATGG + Intronic
966765691 3:183459983-183460005 AGGTTTGGACAGAGGCAATCTGG + Intergenic
966909731 3:184552393-184552415 TGGTTTGGGCAGTGGGTGGATGG + Intronic
966987719 3:185197450-185197472 AGGGTTGGGGAGAGGGAAAATGG - Intronic
967409733 3:189155102-189155124 TGGTTGGGGAAGAGGGAGCAAGG + Intronic
967651076 3:191987994-191988016 AGGTGGGGGTGGAGGGAGTAGGG - Intergenic
967779535 3:193420048-193420070 AGGTTTGGGACCAGGGAGCAGGG - Intronic
969083408 4:4637714-4637736 AGGTTTGGGCACAGGGACACAGG - Intergenic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969660164 4:8522794-8522816 AGGTTTGGCCGGAGGGAGCAGGG + Intergenic
970556370 4:17237162-17237184 TGGTTTGGCCAGAGTGAGAAAGG + Intergenic
971341019 4:25769178-25769200 AGGTTCGGTGAGGGGGAGTAAGG + Intronic
972547639 4:40095670-40095692 AGATTGGGGCAGAGGGAGCAGGG + Intronic
972931112 4:44072267-44072289 AGGAGGGGGCAGAGGGAGCAGGG + Intergenic
973854383 4:54996155-54996177 ATGTTGGAGCTGAGGGAGTAGGG - Intergenic
975405201 4:73981358-73981380 AGGGTTGGGCAGAGGAGGCACGG + Intronic
976118301 4:81751860-81751882 AGTTTTGGGCGGATGGAGCAGGG - Intronic
976316879 4:83667826-83667848 AGGGTTGGGCAGAGGTAGGAAGG + Intergenic
977322319 4:95532984-95533006 AGGTTTGAGGAGAGTGAGAAAGG + Intronic
978554552 4:109964912-109964934 AGTTTGGGGCATAGGAAGTATGG + Intronic
979309386 4:119184284-119184306 AGGGTGGGGCAGAGGGAACAGGG - Intronic
981295834 4:143130113-143130135 AGGGTTGGGGATAGGGAGGATGG + Intergenic
981811659 4:148782446-148782468 AGGGTGGGGCAGAGAGAGTAAGG - Intergenic
982237779 4:153267993-153268015 AGGTAGGGGCAGGGGAAGTAGGG + Intronic
982595064 4:157372154-157372176 TGCTTAGGGCAGAGTGAGTATGG - Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982670633 4:158316416-158316438 AGGTTTGGACAGAGTCAGTTTGG - Intronic
982711850 4:158766273-158766295 AGGTTAGGGCAGAGGGATTGTGG + Intergenic
983100603 4:163621807-163621829 TGGTTTGGGCAGAGGGTGTGGGG + Intronic
984490685 4:180431072-180431094 AGGCCTGAGCACAGGGAGTAAGG - Intergenic
985485584 5:146522-146544 AGGTTGGGGAAGAGGAAGGAGGG - Intronic
985487117 5:158158-158180 AGGATAGAGCAGAGGGAGGAGGG - Intronic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985601892 5:839724-839746 TGGTCAGGGCAGAGGGAGTTGGG - Intronic
985666412 5:1183664-1183686 AGGGCTGGGCAGAGGCAGGAAGG + Intergenic
985892158 5:2724428-2724450 AGAGTTGGGCTGAGGGAGAAGGG - Intergenic
985895929 5:2750160-2750182 AGGGAGGGGAAGAGGGAGTAGGG - Intronic
988780455 5:34516569-34516591 GGGCTTGGACAGAGGGAGAATGG - Intergenic
988788595 5:34586522-34586544 CGGGTTGGGGAGAGGGACTAGGG - Intergenic
989439911 5:41458117-41458139 AGGCGTGGGATGAGGGAGTAGGG - Intronic
989788271 5:45358389-45358411 AGGATTGGGATGAAGGAGTAGGG - Intronic
990569062 5:57059638-57059660 AGGTTTTAGCTGAGGGAGTAAGG - Intergenic
991594847 5:68292708-68292730 AGCTTTGGGAAGGGGGAGTAAGG + Intronic
992099910 5:73396972-73396994 TGCTTAGGGCAGAGGGAATATGG + Intergenic
992528781 5:77636751-77636773 GGATTTGGGCAAAGGGAGCAGGG - Intronic
992737840 5:79741573-79741595 AAGTTTGGGGTTAGGGAGTAGGG + Intronic
993715361 5:91270727-91270749 AGCTTTGAGCAGTGGCAGTATGG + Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
998026246 5:138819092-138819114 AGGTTTGGGCCCAGGGAGCAGGG + Intronic
998040885 5:138950436-138950458 AGGCGTGTGCAGAGGGAGTGAGG + Intronic
998177218 5:139909318-139909340 AGGTAGGGGAAGAGGTAGTATGG - Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998367141 5:141638878-141638900 AGGTTGGAGAAGAGGGAGCAAGG - Intronic
998472112 5:142391488-142391510 AGGATGGGGCAGAAGGAGAAGGG + Intergenic
1001403222 5:171458684-171458706 AGGTGGGGGCAGAGGCAGTGGGG + Intergenic
1002192248 5:177484404-177484426 AGGTTTGGGGTGAGGGAATCAGG - Intronic
1002517120 5:179766830-179766852 AGTTGTGGGAAGAGGGAGGAGGG + Intronic
1003099447 6:3165751-3165773 AAGTATGGGAAGAGGGAGTGAGG + Intergenic
1003144581 6:3499097-3499119 AGTTGGGGGCAGAGGGAGCAGGG + Intergenic
1004125079 6:12865220-12865242 AGGACTAGGCAGAGGGAGGAAGG + Intronic
1004323078 6:14648190-14648212 GGGTTTGGGTAGCGGGAGGATGG - Intergenic
1004557640 6:16715017-16715039 AGGAGAGGGGAGAGGGAGTATGG - Intronic
1006011899 6:31049483-31049505 GGGTTTGGGAAGTGGGAGAAGGG + Intergenic
1006452746 6:34114576-34114598 AGGGTTGGGCAGAGGGTGAGTGG - Intronic
1006603664 6:35242045-35242067 ATGTTAGGGCAGAGGGAGTGAGG - Intronic
1006642894 6:35497628-35497650 AGGTCGGGGAAGAGGGAGAAAGG - Intergenic
1006791379 6:36703491-36703513 AGTTTGGGGCAAAGGGAGCAGGG + Intronic
1007105343 6:39279813-39279835 AGGGTCAGGCAGAGGGAGTGAGG + Intergenic
1007357526 6:41332415-41332437 AGGCTGGAGCAGGGGGAGTATGG - Intergenic
1007420159 6:41714460-41714482 AGGATGGGGAAGAGGGAGCAGGG + Intronic
1007449930 6:41935113-41935135 AGGATGGGGCAGAGGGACAATGG + Exonic
1008584657 6:52937771-52937793 ACTTTTGGGCAGAGAGAGAAAGG - Intergenic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1012221030 6:96649569-96649591 AGCTTTGCACAGTGGGAGTATGG - Intergenic
1012289383 6:97434110-97434132 AGGGTAGGGGAGAGGGAATAAGG - Intergenic
1013179496 6:107706315-107706337 AGATTTGGGCAGGGGGAGTCTGG - Intronic
1017129639 6:151096892-151096914 AGTCTTGGGAAGAGGGAGCAAGG - Intronic
1017234265 6:152103398-152103420 GGTGTTGGGCAGAGGGAGTGAGG - Intronic
1018059390 6:160078797-160078819 AGCTTTGGGAAGAGGGAGGTAGG + Intronic
1018367563 6:163137547-163137569 AGGTTTGGGGGGATGGAGAAAGG - Intronic
1018959197 6:168434698-168434720 AGCTTAGGGCTGAGGGAGGAGGG + Intergenic
1019079157 6:169417821-169417843 TGGTGAGGGAAGAGGGAGTATGG - Intergenic
1019563438 7:1668788-1668810 AGGTCGGGGCAGAGGGAGAAAGG + Intergenic
1020261869 7:6535404-6535426 AGGCTTGGGGAGAAGGAGAAGGG - Intronic
1020866321 7:13568630-13568652 TGTATGGGGCAGAGGGAGTATGG - Intergenic
1021569728 7:22052596-22052618 AGGTTGGGGTGGAGGGAGGAAGG + Intergenic
1023058321 7:36307253-36307275 AGGGTTTGGAAGAGGGAGGAGGG - Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1026565557 7:71487172-71487194 AGATTTGGGTACAGGGAGTGAGG - Intronic
1027277372 7:76572301-76572323 AGGTTTACTCAGAGGGAGAAAGG + Intergenic
1027362399 7:77422788-77422810 AGGTTGGGGAACAGGGAGTGGGG - Intergenic
1027421979 7:78025726-78025748 AAGTTTGGGGAGAGGGAACAAGG + Intronic
1029246044 7:99202388-99202410 AGGTTGGGGTAGATGGAGAAGGG + Intronic
1029469942 7:100748023-100748045 GGGTCTGGGCACAGGGAGTAGGG + Intronic
1030313874 7:108094424-108094446 AGGATGGGGCAGAGGGGGTGGGG - Intronic
1033403761 7:141052249-141052271 AGCTTTGTGCAGTGGCAGTAAGG + Intergenic
1034267819 7:149789724-149789746 AGGTGTGGGCAGAGAAGGTAGGG - Intergenic
1034422116 7:150995768-150995790 GGGTCGGGGCAGAGGGAGGAGGG - Intronic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034568296 7:151933308-151933330 AGGTTTGGGAACAAGGGGTAGGG + Intergenic
1034738349 7:153450224-153450246 AGGCTTGTGCAGAGGGAGAAAGG + Intergenic
1034959805 7:155358237-155358259 AGCTGTGGGCAGAGGGACTTTGG - Exonic
1035596143 8:859563-859585 AGGTTTGGGCAGGGGGCGATGGG - Intergenic
1036052848 8:5219198-5219220 AGGATTGGGCTGAGGGAGAGCGG - Intergenic
1036782948 8:11662554-11662576 GGGGTTGGGTAGTGGGAGTAAGG - Intergenic
1037071913 8:14661037-14661059 AATTTTGGGCAGAGGGATTCTGG - Intronic
1037446044 8:18966909-18966931 AGGCTTGGGTAGGGGGAGAAGGG + Intronic
1037528400 8:19750166-19750188 AGGTTTGGGTACAAGGGGTAAGG - Intronic
1037768241 8:21784704-21784726 AGGTCTGGTCAGTGGGAGAAGGG - Intronic
1039256901 8:35729036-35729058 ATGTTTGGGCAGGAGGAGTGGGG + Intronic
1039382943 8:37102856-37102878 GGGGTTGGGGAGAGGGAGGATGG - Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1041249424 8:55919899-55919921 AGGGTTGGGCGGGGGGAGTGGGG + Intronic
1041686159 8:60646584-60646606 TGTTTTGGGCAGTGGGAGAAGGG - Intergenic
1044828829 8:96225080-96225102 AGGTTTGGGAAGGGGGAAGAGGG + Intergenic
1045357240 8:101400100-101400122 GGGTTTGGGCAAAGGTACTATGG + Intergenic
1046744571 8:117862988-117863010 AGGTGTTGGCAGAGGAAGGAAGG + Intronic
1046798647 8:118399644-118399666 AGGATTGGGCAGAAGAAGTTGGG - Intronic
1048610002 8:136011911-136011933 AGTTTGGGGCAGGGGGAGGAGGG - Intergenic
1048985272 8:139731592-139731614 AGGTGGGGGCTGAGGGCGTAGGG + Intronic
1049440039 8:142605214-142605236 AGGCATGGGGAGAGGGAGTCTGG + Intergenic
1049565580 8:143336299-143336321 AGGTTTTGTAAGAGGGAGTGTGG + Intronic
1050427017 9:5521963-5521985 AGGTTTAGACAGGGAGAGTAGGG - Intronic
1051502436 9:17792627-17792649 AGGTTTGGACAGAGGGAAGGAGG - Intronic
1051888475 9:21919310-21919332 AGGTAGGGACAGAGGGAGTGGGG - Intronic
1052348771 9:27436958-27436980 AGGCTCGGGGAAAGGGAGTAGGG + Intronic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052864766 9:33458232-33458254 AGGCTTGGGAAGAAGGAGAAGGG + Intergenic
1053295506 9:36910187-36910209 ATGTTTAGGCAGAGGGTGTGGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053928088 9:43087862-43087884 AGGTGAGGGGAGAGGAAGTAGGG - Intergenic
1054285567 9:63165119-63165141 AGGTGAGGGGAGAGGAAGTAGGG + Intergenic
1054291235 9:63295361-63295383 AGGTGAGGGGAGAGGAAGTAGGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054389256 9:64599901-64599923 AGGTGAGGGGAGAGGAAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054506462 9:65916472-65916494 AGGTGAGGGGAGAGGAAGTAGGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054832748 9:69644681-69644703 TGGTTTGAGTAGAGGGAGTTGGG + Intronic
1056692506 9:88819879-88819901 AGGGATGGGCATAGGGAGAAAGG - Intergenic
1057007479 9:91573333-91573355 AGCTGAGGTCAGAGGGAGTATGG + Intronic
1057193532 9:93100718-93100740 AGGTGTGGGCAGAAGGAGAAAGG - Intronic
1057978069 9:99628141-99628163 AGGTATGGGTAGATGGAGCAGGG - Intergenic
1059367031 9:113794324-113794346 AGTTGAGGGCAGAGGGAGTTTGG - Intergenic
1059459132 9:114418614-114418636 AGGCCAGAGCAGAGGGAGTACGG - Intronic
1059754672 9:117281642-117281664 AGGCTGGGGCAGAGGAAGTTGGG + Intronic
1060213339 9:121723751-121723773 AGGATTGGGCCCAGGGGGTAGGG + Intronic
1060973703 9:127753243-127753265 AGGCGTGGGCAGAAGGAGTGGGG + Intronic
1186499586 X:10040689-10040711 AGGCTTGGAGAGAGGGAGAAAGG - Intronic
1190394775 X:49970412-49970434 AGGTGCGGGTAGGGGGAGTAGGG - Intronic
1190932565 X:54961840-54961862 AGATATGGGCAGCGGGAGTCAGG + Intronic
1192232143 X:69272763-69272785 AGGACTGGACAGACGGAGTAGGG + Intergenic
1192555218 X:72083915-72083937 GTGTGTGGGCAGGGGGAGTAAGG - Intergenic
1192866546 X:75139176-75139198 AATTTTGAGCAGAGGGAATAAGG - Intronic
1194079554 X:89443063-89443085 AGATTGGGGCAGAGTGACTATGG - Intergenic
1194422952 X:93699043-93699065 GGTCTTGGGCAGAGGGAATATGG + Intronic
1195208709 X:102629564-102629586 AGTTTAGGGCTGAGTGAGTACGG + Intergenic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1196145531 X:112312807-112312829 AGGTTTGGGGAGACAGAGTTGGG - Intergenic
1197256663 X:124270621-124270643 AGGTCTGGGCAAAGGGAGGGTGG + Intronic
1198647294 X:138823217-138823239 AGGATTGGGCAGTGGGGCTATGG + Intronic
1200432174 Y:3098370-3098392 AGATTGGGGCAGAGTGACTATGG - Intergenic
1200770848 Y:7124035-7124057 AGGAGTGGCCAGAGGGAGAATGG + Intergenic
1201765319 Y:17569314-17569336 AGATCAGGGCAGAGGGACTAGGG + Intergenic
1201836233 Y:18336675-18336697 AGATCAGGGCAGAGGGACTAGGG - Intergenic
1202275952 Y:23119667-23119689 ATGTTTGGGCCTAGGGAGCAGGG - Intergenic
1202290076 Y:23301024-23301046 ATGTTTGGGCCTAGGGAGCAGGG + Intergenic
1202428945 Y:24753386-24753408 ATGTTTGGGCCTAGGGAGCAGGG - Intergenic
1202441846 Y:24916703-24916725 ATGTTTGGGCCTAGGGAGCAGGG + Intergenic