ID: 1107071427

View in Genome Browser
Species Human (GRCh38)
Location 13:36274041-36274063
Sequence ATAGAGAAGGAGAATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 881
Summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 805}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107071427_1107071431 5 Left 1107071427 13:36274041-36274063 CCCACTTCATTCTCCTTCTCTAT 0: 1
1: 0
2: 5
3: 70
4: 805
Right 1107071431 13:36274069-36274091 CTTCCTATGAGTTGTGTTTTAGG 0: 1
1: 0
2: 0
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107071427 Original CRISPR ATAGAGAAGGAGAATGAAGT GGG (reversed) Intronic
900040533 1:458944-458966 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
900061963 1:693915-693937 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
900770059 1:4533794-4533816 AGAGAGAAGGTGAATGAATAGGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901243603 1:7710719-7710741 ATAGAGGAGGAGAGTGGGGTGGG - Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
902092602 1:13915533-13915555 ACAGAGAAGGAGGAGGAAATTGG - Intergenic
902200594 1:14830654-14830676 AGAGAGAAAGAGAGTGAAGGGGG + Intronic
902217106 1:14941213-14941235 ACAGAAAAGGTGAATGAAGACGG - Intronic
902783673 1:18719754-18719776 CTAGACAAGGAGAATGAAGTTGG - Intronic
903105046 1:21070514-21070536 ATTTAGAACAAGAATGAAGTAGG - Intronic
904250766 1:29222693-29222715 GGAGAGAAGGAGAGTGAAGAGGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904350692 1:29903641-29903663 AAAGATAAAGAGAATGAACTTGG + Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904958813 1:34313910-34313932 ATATTGAGGGAGAATAAAGTTGG - Intergenic
905466713 1:38159929-38159951 GTAGAGATGGAGAGAGAAGTTGG + Intergenic
905699910 1:40004185-40004207 AAAGAAATGTAGAATGAAGTTGG + Intergenic
905707693 1:40074336-40074358 AAAGAGAAAGAAAAAGAAGTAGG - Intronic
906174743 1:43761505-43761527 AGAGAGAAGGAGAAAGAAAAGGG + Intronic
906575287 1:46884055-46884077 GTAGAGAAAGAGCATGAGGTAGG + Intergenic
906879465 1:49574848-49574870 AAAGACAAGCAGAATGCAGTAGG - Intronic
907484129 1:54765323-54765345 TTAGAGAAGGAGAATGGAGTGGG + Intergenic
907539333 1:55198345-55198367 ATGGAAATGGAGGATGAAGTCGG + Intronic
907649639 1:56282774-56282796 ATGGTGAGGGAGAAGGAAGTTGG + Intergenic
907949887 1:59172428-59172450 ATAGAGAAAGAAAATGAAAATGG - Intergenic
908005867 1:59728522-59728544 AGAGAGAAGGAAAATGATATAGG - Intronic
908064185 1:60384662-60384684 AGAGAGTAGGAGCAAGAAGTGGG - Intergenic
908744537 1:67362805-67362827 AGAGAGAAGGAAAATGAGATAGG + Intronic
909038014 1:70617227-70617249 AGAGAGAGAGAGAATGAAGGCGG + Intergenic
909187680 1:72509773-72509795 AAAGAGAAAGAGATTCAAGTTGG - Intergenic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
910022457 1:82608744-82608766 ATAAATAAGTAGAATTAAGTAGG - Intergenic
910178562 1:84457227-84457249 GAAGAGAAGGAGAGTGAAGAAGG + Intergenic
910432751 1:87175245-87175267 ACAGATAAGGAAACTGAAGTTGG + Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911959163 1:104277585-104277607 ATAGAAAAGGAAAATGCAGATGG + Intergenic
912489307 1:110052991-110053013 ACAGAGGAGGAGAATGAAAAAGG - Intronic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
912918383 1:113841236-113841258 AAAAAGAGAGAGAATGAAGTTGG + Intronic
913065346 1:115247480-115247502 CTAGGGAAAGAGAATGTAGTAGG - Intergenic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
914919283 1:151836925-151836947 AGGGAGAGGGAGAAAGAAGTTGG + Intergenic
915022051 1:152788192-152788214 AGTGGGAAGGAGGATGAAGTCGG - Exonic
915023011 1:152798674-152798696 AGTGAGAAGGAGGATGAAGTCGG - Intronic
915245308 1:154552102-154552124 AAAGTTAAGTAGAATGAAGTCGG + Exonic
915957207 1:160231369-160231391 AAAGAGAAAGAGAAGAAAGTGGG - Exonic
916028536 1:160856231-160856253 ATAGAGAGGAAGAAAGAAATGGG - Intronic
916125866 1:161570545-161570567 AAAGAGAAGAAGAATGTATTAGG - Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
917708047 1:177654615-177654637 AAAGAGAAGGAAAAAGAAGTAGG - Intergenic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
918082477 1:181218199-181218221 ATAAAGAATGTGAATGATGTGGG + Intergenic
918371505 1:183866387-183866409 AAAGTGAAGAAGAATGAAGCAGG + Intronic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919277918 1:195445047-195445069 GTAGAGAAGGACCATCAAGTGGG - Intergenic
919445925 1:197705131-197705153 CTAGTTAAGGAGAATGCAGTTGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919867609 1:201794047-201794069 ATAGAGAAGGGCAAGGAATTGGG - Intronic
920008816 1:202853034-202853056 CTGGAGAAGGATTATGAAGTAGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921093280 1:211863441-211863463 ATATTGAAGGAGAACAAAGTTGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921420526 1:214942097-214942119 AATGAGAAGGAGACTGATGTAGG - Intergenic
921645448 1:217610475-217610497 ATAGAGAAAGAAAAGTAAGTTGG + Intronic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
921894084 1:220380689-220380711 AAAGAGAAAGAGAAAGAAATGGG + Intergenic
922114299 1:222595793-222595815 AGAGAGAGAGAGAAAGAAGTGGG - Intergenic
922174742 1:223188738-223188760 ATAAAGAAGGAGGAGGAAGGGGG + Intergenic
922181435 1:223236795-223236817 ATATTGAAGGAGAACAAAGTGGG - Intronic
922665764 1:227467169-227467191 ATAGATAAGGAGAATGGGATGGG - Intergenic
923846077 1:237734294-237734316 AGAGAGAGAGAGAATGGAGTGGG + Intronic
923909541 1:238425737-238425759 AAAGAGAAGAACTATGAAGTAGG - Intergenic
924080025 1:240386051-240386073 ATAGAGAAGGAAGATGCATTGGG + Intronic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924481152 1:244435533-244435555 GTAGAGGAGGAGGATGAAGGAGG - Intronic
924481166 1:244435612-244435634 GTAGAGGAGGAGGATGAAGGAGG - Intronic
924744953 1:246823088-246823110 ATTTTGAAAGAGAATGAAGTTGG - Intergenic
1062878655 10:961172-961194 TCAGAGAAGGAAAATGACGTAGG + Intergenic
1062978447 10:1702007-1702029 AAAGACAAAGAGAAAGAAGTGGG + Intronic
1063207539 10:3848714-3848736 ATAGAGAGAGAGAAAGAAGTAGG - Intergenic
1063286765 10:4697103-4697125 ATAGAAATGGAGAATGCAGAAGG + Intergenic
1063331574 10:5164883-5164905 AGAGAGAAAGAAAATGCAGTAGG - Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1064429578 10:15259113-15259135 ATAGATAGGGAGAATGATGATGG - Intronic
1064482878 10:15757061-15757083 AGAGAGAAGGGGAATGAAGATGG + Intergenic
1064615130 10:17145649-17145671 ATAGACAAAGAGATTAAAGTGGG - Intronic
1064982722 10:21180583-21180605 ATAGAGAAGGAGGGGGAATTTGG - Intergenic
1065399707 10:25285242-25285264 AGAGAGAAGGAGAAAGAAAGAGG - Intronic
1065540177 10:26756972-26756994 ATAGAGTATTAGAATGAAATAGG - Intronic
1066566656 10:36728484-36728506 AGAGTGAAGGAGGAGGAAGTGGG + Intergenic
1067319847 10:45207473-45207495 ATATTGAAGGAGAACAAAGTTGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067699197 10:48556400-48556422 ATACAGAAGGAGGATAAAGGAGG - Intronic
1067706804 10:48612119-48612141 ATAGAAAAGCAGGAGGAAGTTGG - Intronic
1069186713 10:65431979-65432001 ATTGACAAGGAGAAGGTAGTTGG + Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1070095473 10:73333763-73333785 AGAGAGAAGGAAAATGACATGGG + Intronic
1070366707 10:75743700-75743722 TTAGAGAAGGAAAAGGAAATGGG + Intronic
1070464941 10:76711870-76711892 GTAGAGAAGGAGCATCAGGTGGG - Intergenic
1070715085 10:78714176-78714198 ATAAAGCAGGAAAATGAAATTGG + Intergenic
1070948833 10:80414550-80414572 AAAGAAAAGAAGAAAGAAGTCGG - Intronic
1071403951 10:85310212-85310234 AGAGAGAAGGAAAATGATATAGG + Intergenic
1071425572 10:85545748-85545770 TTTCAGAAGGAGACTGAAGTTGG - Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072942371 10:99778003-99778025 AGAGAGAAGGAAAATGATATAGG - Intergenic
1073325126 10:102639582-102639604 ATAGAGATGGGGAATGCAGGAGG + Intergenic
1073721699 10:106180046-106180068 ACAGAAAAGGAGCATGGAGTGGG + Intergenic
1073963408 10:108960287-108960309 ATAGAGATGGAGAATGTGTTTGG - Intergenic
1074007573 10:109443691-109443713 ATAGAGGAGTAGAAAGAAGTAGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074963121 10:118465595-118465617 AGAGAGAAAGAGAAAGAAGGAGG + Intergenic
1075822430 10:125326386-125326408 ATAGAAAAGTTGAATGAACTGGG - Intergenic
1075918351 10:126189177-126189199 ATAGAGAAGGATCATGATGAAGG + Intronic
1075979157 10:126722314-126722336 AGAGAAAAGGAGAATGAAGTGGG + Intergenic
1076270659 10:129149579-129149601 AAAAAGAAGGAAAGTGAAGTAGG - Intergenic
1076365371 10:129918299-129918321 ATGGAGAATGAGACAGAAGTGGG - Intronic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076736443 10:132461257-132461279 AAAGAGGAGGAGGATGAAGGAGG - Intergenic
1076966806 11:95167-95189 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1077784372 11:5366614-5366636 ATAGAGAAAGAGAGAGAGGTAGG + Intronic
1077880450 11:6345334-6345356 AGAGAGAAGGAGAGGGAAGGAGG - Intergenic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078095043 11:8291665-8291687 ATAGAGAAGGAAAAGGCAGGTGG + Intergenic
1078209867 11:9262288-9262310 ATAGAGCATAAGAATGAAGCTGG - Intronic
1079388055 11:19998292-19998314 AGAGAGAAGGAGAGGGAGGTGGG - Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079707492 11:23638680-23638702 AGAGAGAGAGAGATTGAAGTGGG + Intergenic
1080544705 11:33304606-33304628 ATAGAGAAAGGACATGAAGTAGG + Intronic
1080583085 11:33659206-33659228 TGAGAGAAGGGGAATGAAATGGG - Intronic
1080951857 11:37043088-37043110 ATAGATAAGTAAACTGAAGTTGG - Intergenic
1081262038 11:40972656-40972678 AGAGAGAATGAGAGCGAAGTTGG + Intronic
1081555705 11:44158721-44158743 AGAGAGAAGGAAAATGATATAGG - Intronic
1082662683 11:55932214-55932236 AAAGAGGAGGGGAATGGAGTGGG + Intergenic
1083055884 11:59819242-59819264 AAAGACAGGGAGAAAGAAGTTGG + Intergenic
1083072376 11:59998682-59998704 ATAGAGAAGGATGATACAGTAGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084130719 11:67132171-67132193 ATAGATGAGCAGACTGAAGTAGG + Intronic
1085158343 11:74317520-74317542 AAAGAGAAAGAGAAGGAAGGAGG - Intergenic
1085196570 11:74675961-74675983 GTAGAGATGGAGAATGATGGCGG + Intergenic
1087211818 11:95452803-95452825 AAAGAGAAGGAGGGTTAAGTGGG + Intergenic
1087389426 11:97514887-97514909 AAAGAGAAGGAGTGTGGAGTAGG + Intergenic
1087414773 11:97840158-97840180 GAAGAGGAGGAGAAAGAAGTGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087609911 11:100422020-100422042 AGAGAGAAGGAAAATGATATAGG + Intergenic
1087655501 11:100917926-100917948 AAAGAGAAGCTGAATGATGTGGG - Intronic
1087975383 11:104539400-104539422 AAAAAGAGGGAGAAAGAAGTGGG + Intergenic
1088000822 11:104878077-104878099 AAAAACAAGGAGAATGAATTGGG + Intergenic
1088429192 11:109739518-109739540 AAAGAGAAGGAGAAGGACATAGG + Intergenic
1088701332 11:112415102-112415124 TTAGAGAATGATAATAAAGTTGG + Intergenic
1088894180 11:114065293-114065315 ATAGAGAAGGAAACGGAAGCCGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090556550 11:127882888-127882910 AGAAAAAAGGAAAATGAAGTAGG + Intergenic
1090856851 11:130617190-130617212 ATCAAGTAGGAGAATGATGTAGG - Intergenic
1090869438 11:130730051-130730073 ATAGAGAATGAGAAAGAAAAAGG - Intergenic
1091237550 11:134032274-134032296 AGAGAGCAGGAGAATGAACATGG + Intergenic
1091462194 12:652432-652454 AGAAAGAAGGAAAATGAAGCTGG + Intronic
1091462212 12:652530-652552 AGAAAGAAGGAAAATGAAATAGG + Intronic
1092085121 12:5750710-5750732 ATAGCGAAGGAGAATGATAGAGG + Intronic
1092173547 12:6388199-6388221 ATAGAGAAGGGGAACTAAGTTGG - Intronic
1092364486 12:7865629-7865651 AGAGAGAAGGAGAGAGAAATGGG - Intronic
1092536892 12:9396861-9396883 AGAGAGAGAGAGAAAGAAGTGGG - Intergenic
1092557786 12:9576446-9576468 AGAGAGAGAGAGAAAGAAGTGGG + Intergenic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1092838653 12:12516944-12516966 TTACTGAAGGAGAAGGAAGTGGG - Intronic
1093737482 12:22638126-22638148 GAAGGGAAGGAGAAAGAAGTTGG + Intronic
1093888861 12:24495309-24495331 AAAGAGAACCAGTATGAAGTAGG + Intergenic
1094150409 12:27276415-27276437 ATAGAGAAGGAGAAAGCACAGGG - Intronic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094274775 12:28660201-28660223 AGAGAGAAGGAAAATGATATAGG + Intergenic
1095180541 12:39142956-39142978 AGAGAAAATGAGAATGAAGGGGG - Intergenic
1095197048 12:39332332-39332354 ATAGTCAAGGAGAATGGAGAGGG - Exonic
1095248169 12:39946462-39946484 ATAGGAAAGGACCATGAAGTAGG + Intronic
1095562221 12:43579061-43579083 ACAGAGAACGAGACTGATGTAGG + Intergenic
1095622626 12:44276450-44276472 ATAGAAAAAGAGAATAAAATGGG + Intronic
1095843560 12:46721235-46721257 AAAGAGAAGGAGAATAAAGATGG - Intergenic
1095900769 12:47325724-47325746 AAAGAGAATGAGAATGAGATAGG + Intergenic
1096412692 12:51388690-51388712 ATTGGGAAGGAGAAGGAAATAGG - Intronic
1096727715 12:53578484-53578506 AGAGAGAAGGAAAATGAGCTAGG + Intronic
1096956864 12:55534889-55534911 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1097402396 12:59145376-59145398 AGAGAGAAAGAGATTGAAATGGG + Intergenic
1098080758 12:66782849-66782871 ACAGAGAAGGAAACTGAAGATGG + Intronic
1099517335 12:83613597-83613619 TTACAAAAGGAAAATGAAGTTGG + Intergenic
1099539850 12:83894235-83894257 ATAGAGAAAGAGAGAGAAGAGGG - Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099609430 12:84848680-84848702 ATAGAGAAAGAGAAAGAAATAGG + Intergenic
1100017785 12:90032596-90032618 ATACTGAAGGAGAACAAAGTTGG - Intergenic
1100282162 12:93128232-93128254 ATAGGGAAGGAGAGTGAGGGCGG + Intergenic
1100673243 12:96838861-96838883 AAAGATGGGGAGAATGAAGTGGG + Intronic
1100702589 12:97163938-97163960 ATAGAGAGTGGGAATAAAGTGGG + Intergenic
1101024352 12:100585912-100585934 TGAGAGAAGGAGAAACAAGTAGG - Intronic
1101688857 12:107055611-107055633 ATAGTGAAGGCAAATAAAGTTGG + Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103022975 12:117551243-117551265 GAAGAGAAGGAGAAAGAAGGAGG - Intronic
1103241740 12:119419168-119419190 AGAGAAAAGGAGGAGGAAGTGGG - Intronic
1103263332 12:119608465-119608487 AATGAGAAGGAAAATGAAGGAGG + Intronic
1103858857 12:123995550-123995572 TTGGAGAAGGAGAATGGAGGTGG + Intronic
1104384414 12:128338021-128338043 AGAGACAAGGAGTGTGAAGTTGG - Intronic
1104519240 12:129457733-129457755 AGAGAGAAAGAGAGTGAAGAGGG + Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105586516 13:21749797-21749819 AAAGAGAAAGAGATTGAAATAGG - Intergenic
1105685851 13:22781064-22781086 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1105716798 13:23074490-23074512 ATAGAGAAGGGAAAGGAATTTGG - Intergenic
1106011757 13:25830720-25830742 ATGGAGAAAGAGAATGCAATTGG - Intronic
1106487434 13:30184836-30184858 TTAAAGAGGCAGAATGAAGTAGG - Intergenic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107167711 13:37301830-37301852 ACAGAGAAGGAGAAAAAAGATGG - Intergenic
1107205231 13:37777364-37777386 AGAGAGAAAGAGAGTGAAGGGGG + Intronic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107799514 13:44091452-44091474 AGAGAGATGGAGAATACAGTAGG - Intergenic
1107939906 13:45374363-45374385 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1108051528 13:46445763-46445785 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1108256686 13:48618065-48618087 TAAGAGAAGGAGAATGAAGGGGG + Intergenic
1108836133 13:54551702-54551724 AGAGAGAAGGAAAATAATGTAGG - Intergenic
1108951660 13:56101576-56101598 CGAGAGAGGGAGAATAAAGTTGG + Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109233950 13:59792781-59792803 AAAAAGTAGGAGAATGAAGGAGG - Intronic
1109544081 13:63819388-63819410 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1109887798 13:68564941-68564963 AGAGAGAAAGAGAGTGAAGTGGG + Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110240596 13:73262136-73262158 ATAGAGCATGAGTGTGAAGTAGG - Intergenic
1110639963 13:77812254-77812276 ATAGGAAAAGAAAATGAAGTTGG + Intergenic
1110945471 13:81409749-81409771 ATAGTGTAGGAGAAGAAAGTTGG - Intergenic
1111398037 13:87693375-87693397 AGAGAGAAGGAGACTGAAAGGGG - Exonic
1111398917 13:87706395-87706417 AAAGATTAGGAGAATGAATTGGG - Intergenic
1111686379 13:91506164-91506186 ATAGTGAAAGAGAATGAACTTGG - Intronic
1112067102 13:95804500-95804522 ATTGTGAAAAAGAATGAAGTTGG + Intronic
1112109009 13:96273987-96274009 AGAGAGAAGGAGAAGGGAGGGGG - Intronic
1112757973 13:102660935-102660957 ATATAGAAAAAGAATGAAGTTGG + Intronic
1112950476 13:104989704-104989726 AAAGAGAAGGAAACTGAAATAGG + Intergenic
1112970128 13:105251616-105251638 ACAGATAAGTAGAGTGAAGTAGG + Intergenic
1113269924 13:108662384-108662406 ATAGGGAAGGACCATTAAGTGGG + Intronic
1113792479 13:113036495-113036517 AGAGAGCAGGAGAATAAAGCAGG + Intronic
1113840813 13:113360176-113360198 CTCGAGATGGAGAATGAAATAGG + Intronic
1113862230 13:113494595-113494617 GAAGAGAAGGAGACTGAATTGGG + Intronic
1114533894 14:23411353-23411375 CTAGGGAAGGAGAATGGAGGTGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115138016 14:30134440-30134462 AAAAACATGGAGAATGAAGTAGG - Intronic
1115760357 14:36574831-36574853 AGAGAGAGAGAGAATGCAGTTGG + Intergenic
1116045409 14:39736787-39736809 AAAGAGAATGAGATTGAATTGGG + Intergenic
1116205610 14:41862039-41862061 AGAGAGAAGGTGAGTGAAGTAGG - Intronic
1116477469 14:45358090-45358112 ATATAGAAGCAGAAGGAATTAGG + Intergenic
1117774523 14:59169087-59169109 ATGAAGGAGAAGAATGAAGTTGG + Intergenic
1117791026 14:59342535-59342557 ACATAAAAGGAGAAAGAAGTAGG + Intronic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1119427680 14:74546444-74546466 ATAGAGAAGGGGCAAGACGTTGG - Intronic
1120085626 14:80269405-80269427 AAAGAGGAGGTGAATGAAGGAGG + Intronic
1120157347 14:81108334-81108356 AGAGAGAGAGAGAATGAATTAGG - Intronic
1120512448 14:85432277-85432299 AGAGAGAGAGTGAATGAAGTAGG + Intergenic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121612774 14:95292938-95292960 ACGGAGCAGGAGAAAGAAGTGGG + Intronic
1121957262 14:98225906-98225928 AGAGAGAAGGGGAAAGAAGGAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122062552 14:99146271-99146293 AAAGAGAAAGAAAATGAAATCGG - Intergenic
1122380572 14:101302300-101302322 AGAGAGAAGGAAAATGAAATAGG + Intergenic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124530626 15:30502354-30502376 ATAATGAAGTAGAAAGAAGTTGG + Intergenic
1124710061 15:32001489-32001511 AGAGAGAAGGAAAATGACATAGG + Intergenic
1124768035 15:32505344-32505366 ATAATGAAGTAGAAAGAAGTTGG - Intergenic
1125497428 15:40209754-40209776 ATTGAGAAGGAAATTGAATTAGG + Exonic
1125658414 15:41377121-41377143 ACAGATGAAGAGAATGAAGTTGG + Intronic
1126199529 15:45970096-45970118 GTAGAGAAGGGAAAGGAAGTAGG - Intergenic
1126558270 15:50015237-50015259 ATAGAGAAAGAAAATGAAGAGGG + Intronic
1126611505 15:50534031-50534053 ACAGAGAAGGAAAATGATATAGG + Intronic
1126759406 15:51955606-51955628 AGAAAGAATGAGAATGAAGCTGG + Intronic
1127137742 15:55942512-55942534 AAGGAGGAGGAGAATGAAGGGGG - Intronic
1127336028 15:57985282-57985304 ATAGATAAGTAGAGTGAATTGGG - Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095733 15:64953538-64953560 AGAAAGAAGGAGAAGGAAGAAGG - Intronic
1128652856 15:69432220-69432242 AGAGAAAAGGAGATTGTAGTTGG + Intronic
1129192758 15:73947033-73947055 GGAGAGAAGGAGAAAGAAGAGGG - Intronic
1130128718 15:81117874-81117896 AAAGAGGAGGAGGATGAAGAAGG - Intronic
1130240064 15:82179729-82179751 GTAGAGAAGGAAAAGGGAGTTGG + Intronic
1130714979 15:86324815-86324837 TTTGAGAAGGTGAGTGAAGTGGG + Intronic
1130892372 15:88144077-88144099 TTAGAGATAAAGAATGAAGTAGG - Intronic
1131031411 15:89189012-89189034 AAAGAGTAGATGAATGAAGTGGG - Intronic
1131487127 15:92830467-92830489 AAAGAGAGAGAGAATGAACTTGG - Intergenic
1131898894 15:97066160-97066182 AAATAGGAGGAGAATGAAGAGGG - Intergenic
1131901074 15:97088552-97088574 AAAGAGGAGGAGGATGAAGGAGG - Intergenic
1131919273 15:97305109-97305131 AAAGTGAAGGAGAATAAAGTTGG - Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132126170 15:99227159-99227181 ATAGAGAAAGAGCATAAATTTGG - Intronic
1132441373 15:101868679-101868701 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1133406471 16:5528587-5528609 AGAGAGAGAGAGAATGAATTGGG - Intergenic
1133498032 16:6338911-6338933 ATAATGCAGGAGAATGAAATGGG + Intronic
1134425566 16:14140625-14140647 ATAGACACCGAGGATGAAGTGGG + Exonic
1135397385 16:22141671-22141693 ACAGAGAAAGGGAATGACGTGGG + Exonic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137551591 16:49441116-49441138 AAAGAGAAGGAGAGAGAAATAGG + Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1138930563 16:61650402-61650424 ATAGAGAAGAATGATTAAGTTGG - Exonic
1139189014 16:64840115-64840137 AAAGAGAAGGAGGCTGAAGGTGG - Intergenic
1139339740 16:66260329-66260351 AAAGAGAGAGAGAATGAAGCTGG - Intergenic
1139629781 16:68222996-68223018 ATAGAGAGGGAATATAAAGTGGG - Intronic
1139960958 16:70717006-70717028 ACAGAGGAGGAGTGTGAAGTAGG - Intronic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1140307092 16:73813214-73813236 AGAGAGAAAGAGAAAGAGGTAGG - Intergenic
1140748854 16:78005277-78005299 GTAGAGGAGGAGAATGAACTTGG + Intergenic
1140899257 16:79352897-79352919 AAATAGATGGAGAATCAAGTGGG + Intergenic
1142379776 16:89724845-89724867 ATAGAGAGAGACAAAGAAGTAGG - Intronic
1144180565 17:12747618-12747640 AGAGAGAAGAGGAATGAAGGAGG + Intronic
1144227338 17:13162355-13162377 AAAGAGAAAATGAATGAAGTGGG + Intergenic
1144246830 17:13374760-13374782 CTAGAGATGGAGAAAAAAGTGGG - Intergenic
1144909371 17:18668326-18668348 ACAGATCAGGAGAATGAAGAGGG - Intronic
1145015033 17:19391012-19391034 AGCGGGAAGGAGAATGAAGTAGG + Intergenic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146597225 17:34180055-34180077 ATATTGAAGGAGAACAAAGTTGG + Intergenic
1146602685 17:34232382-34232404 AGAGTGAAGGAGAGTGAATTAGG - Intergenic
1146662417 17:34673641-34673663 AAAGAGCAGGAGAAGGAAGTAGG - Intergenic
1146772934 17:35585535-35585557 AAAGTGGAAGAGAATGAAGTTGG + Intronic
1148335839 17:46840977-46840999 ACAGGAAAGGAGAATGCAGTTGG - Intronic
1150772016 17:68050311-68050333 AGAGAGAAAGAGAAGGAAGGAGG - Intergenic
1152039919 17:77896374-77896396 ATAGAGAAAAAGAATGTACTGGG - Intergenic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1152818549 17:82423828-82423850 AGAGAGAAAGACAAGGAAGTGGG + Intronic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1154139858 18:11813556-11813578 TTAGAAAAGGAGAACAAAGTTGG + Intronic
1154253025 18:12759779-12759801 AGAGAGAAGGAAAATGATATAGG + Intergenic
1155860140 18:30887592-30887614 AGAGAGAGAGAGAATGATGTTGG - Intergenic
1156340150 18:36203346-36203368 AGAGAGCAAGAGAATGAGGTGGG + Intronic
1156623442 18:38880699-38880721 CTAGGGAAGGAGAAAGAAATAGG + Intergenic
1156721683 18:40077914-40077936 ATAGAGAAGGAAAACAAAATGGG - Intergenic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157951070 18:52037874-52037896 AAAGAGATGGAGAAAGAACTAGG + Intergenic
1158030905 18:52963569-52963591 ATAGTGAAGCAGGATGAAGGTGG + Intronic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158475432 18:57775325-57775347 AAAGAGAAAGAGAAGGAAGGAGG + Intronic
1158724763 18:59960790-59960812 ATAGGCAATGAGACTGAAGTAGG - Intergenic
1159352809 18:67298044-67298066 ACAGAGAAAGAGAATAAAGATGG - Intergenic
1160144579 18:76353143-76353165 ACAGAGAAGGAGATAGAAATGGG + Intergenic
1160643609 19:164790-164812 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1161646149 19:5454706-5454728 ATAGGGAGAGAGAATGAAGCTGG + Intergenic
1161985332 19:7650373-7650395 ATAGAGAATGAAAATGAAGGGGG + Intergenic
1162550943 19:11357792-11357814 ACAGATAAGGAGACTGAGGTTGG - Intronic
1162705987 19:12555272-12555294 AGAGAGAAAGAGAAAGAAGAAGG + Intronic
1162906551 19:13827300-13827322 ATAGAAAAGAAAAAAGAAGTTGG + Intronic
1163376437 19:16935409-16935431 AGGGAGAGGGAGAAGGAAGTAGG - Intronic
1163383466 19:16984341-16984363 AGAGAGAGAGAGAATGAATTTGG + Intronic
1163739217 19:19000330-19000352 AAAGAGAGGGAGAATAAGGTGGG - Intronic
1164325020 19:24183663-24183685 AGAGAGAAAGTGAATGAAGGAGG - Intergenic
1164419848 19:28079342-28079364 TTAGACAATGAGCATGAAGTGGG + Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165375961 19:35442174-35442196 TTAGAAAAGAAGAAGGAAGTTGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167304965 19:48702994-48703016 AAAGACAAAGAGGATGAAGTGGG - Exonic
1167485823 19:49762371-49762393 ACAGGGAAGGAGAATAAAGTAGG - Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
925292683 2:2758240-2758262 GGAGAGAGGGAGAATGAAGGGGG - Intergenic
926510735 2:13774406-13774428 ACAGAGAATAAGAAAGAAGTTGG - Intergenic
926575473 2:14575772-14575794 ACAGAGAATGAGAGGGAAGTAGG + Intergenic
926726844 2:16005174-16005196 AAGGAGAAGGAGAAACAAGTCGG - Intergenic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
926945932 2:18187369-18187391 ATAAAGAAAGAAAATGAAGGAGG - Intronic
927490464 2:23517890-23517912 AATGAGATGGAGAGTGAAGTAGG + Intronic
927537067 2:23871789-23871811 GTAGAGAAGGAGTAGGAGGTGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928452896 2:31394157-31394179 AAAGAGAAGGAAAATGATGTAGG - Intronic
928461091 2:31473340-31473362 TTTGAGAAAGAGAATGAAGGAGG + Intergenic
928495500 2:31827785-31827807 GTAGAGAAGGAGAAAGCAGTAGG - Intergenic
929977996 2:46653678-46653700 ATAGAGCAGGTGAAGGGAGTGGG - Intergenic
930422688 2:51174541-51174563 AAGGAGAAGGAGGATAAAGTTGG + Intergenic
931185733 2:59949300-59949322 AAAGGGAAGGAGAATGAAAGGGG - Intergenic
931195264 2:60046972-60046994 ATAAAGAAGGAGTATTAGGTGGG + Intergenic
932074890 2:68653625-68653647 AGAGAGATGGGGAGTGAAGTGGG - Intronic
932551716 2:72776782-72776804 GGAGAGAAAGAGAAAGAAGTTGG + Intronic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
933885250 2:86713297-86713319 AGAGAGAAGGAAAATGATGTAGG + Intronic
933924924 2:87083386-87083408 AGAGAGAAGGAAAATGATGTAGG - Intergenic
933968445 2:87450401-87450423 AGAGAGAATGAGAAGGAATTTGG - Intergenic
934060562 2:88288667-88288689 ATAGAGCACAAGCATGAAGTAGG - Intergenic
934694899 2:96392646-96392668 AAAGAGAAAGAGAGTGCAGTGGG + Intergenic
934784090 2:96992097-96992119 AGAGAGAAAGAGAGTGAAGGGGG + Intronic
935859638 2:107314755-107314777 ATAGAGAAGGAAAAAGAAAGTGG - Intergenic
935895032 2:107726598-107726620 GGAGAGAAGGAGAGTGAAGAAGG + Intergenic
936014641 2:108948618-108948640 AGAGAGAGAGAGAGTGAAGTGGG + Intronic
936325347 2:111500103-111500125 AGAGAGAATGAGAAGGAATTTGG + Intergenic
936910610 2:117588696-117588718 ATTGAGGAGAAGAATGAAATAGG - Intergenic
937293655 2:120797173-120797195 TAAGAGAATTAGAATGAAGTTGG + Intronic
938100117 2:128492811-128492833 AGAGAGAATGAGAATGAATATGG - Intergenic
938215811 2:129513139-129513161 CTAAAGAAGGAAAATGAAGTTGG - Intergenic
939138739 2:138327693-138327715 ATATTGAAGAAGAATAAAGTTGG + Intergenic
939204456 2:139082176-139082198 ATAAACAAGGTGAATTAAGTTGG + Intergenic
939360675 2:141168788-141168810 ACAGAACAGGAGACTGAAGTGGG - Intronic
939575835 2:143893549-143893571 AAAGATAAGAAGAAAGAAGTAGG + Intergenic
939805327 2:146768740-146768762 ATAGAGAAGGTAAAAGAAGATGG - Intergenic
939831571 2:147078805-147078827 GTGGAGAGGGAAAATGAAGTTGG + Intergenic
939911990 2:147994395-147994417 ATACCGAAGGAGAACAAAGTTGG + Intronic
939914975 2:148028862-148028884 ATATAGAAGGAAAATGATTTTGG - Intronic
939994448 2:148907090-148907112 ACTGAGAAGGACAATGAAGGTGG + Intronic
940860917 2:158769962-158769984 GTACAGAAGGAGAATAAAGGAGG - Intergenic
941703886 2:168636786-168636808 ACACAGAAGGAAAATGAGGTAGG - Intronic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
943287113 2:186016224-186016246 GTAGAGAAGGAGATAAAAGTGGG - Intergenic
943360862 2:186917309-186917331 ATAGGGAAGGTAAATGAAGGTGG + Intergenic
943924215 2:193750800-193750822 GGAGAGAAGGAGAATGGAGAAGG - Intergenic
944142757 2:196475292-196475314 GTAGGGAAGGAGAAGGGAGTGGG + Intronic
944504599 2:200397746-200397768 ATAGGGAGGAAGAAGGAAGTGGG + Intronic
944809518 2:203314357-203314379 CTAGGGCAGGAGAATGAGGTGGG + Intergenic
945410651 2:209502575-209502597 ATACACAAAGAAAATGAAGTCGG - Intronic
945539429 2:211066456-211066478 ATAGACAAAGACAATAAAGTAGG - Intergenic
946011538 2:216568393-216568415 ACAGAGAAGGCAAACGAAGTGGG - Intronic
946276261 2:218634070-218634092 ATAGAGAGGGAGATGGAAGTGGG - Intronic
946347626 2:219123987-219124009 AGAGAGAGGGAGAAGGAAATAGG + Intronic
946375181 2:219303645-219303667 GGAGAGAAGGGGAAGGAAGTGGG - Intronic
946650373 2:221886793-221886815 ATAGACAAGAAGAATGAAAGTGG + Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947405282 2:229769738-229769760 ATTGAGCTGGAGAAAGAAGTGGG + Intronic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
948381384 2:237552127-237552149 AGAGCAAAGGAGAAAGAAGTTGG + Intronic
948531213 2:238606792-238606814 ATAGAGAAGGACCATCAGGTGGG - Intergenic
948552999 2:238787070-238787092 AAAGAGAATGAAAACGAAGTGGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1169501254 20:6162939-6162961 ATAGATCAGGAGAATGAAGAAGG - Intergenic
1169548251 20:6673340-6673362 AGACAGAAGAAGAAGGAAGTTGG - Intergenic
1170136203 20:13076020-13076042 ATTCAGAAGGAGAAAGAACTTGG - Intronic
1170202038 20:13754687-13754709 ATAGATAAGTAGATTAAAGTGGG - Intronic
1170524839 20:17227168-17227190 ATAGAGAAAGAGACTGAACAGGG - Exonic
1170788370 20:19487328-19487350 AAAAAGAAAGAGAATGAAGGTGG - Intronic
1170935216 20:20804003-20804025 AAAGAGGAGGGGCATGAAGTGGG + Intergenic
1170980476 20:21207499-21207521 AGAGAGAAGGTGGGTGAAGTGGG - Intronic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172674261 20:36656451-36656473 ACAGAGAAGCAGAATTAAATGGG + Intronic
1172727476 20:37057080-37057102 ATAGAGAAAGAAAATGCTGTGGG - Intronic
1173168890 20:40706370-40706392 ATAGACAAGGAGAAGGGAATAGG - Intergenic
1173215433 20:41077606-41077628 ATAAAGAAGGAGAAGGAAAATGG + Exonic
1173493857 20:43504901-43504923 AAACAGAAGGGGAATGGAGTGGG - Intergenic
1173564899 20:44031698-44031720 ATAGGCCAGGAAAATGAAGTGGG + Intronic
1174504452 20:51008200-51008222 ATACACAAGGAGACTGAACTGGG + Intronic
1174698969 20:52588761-52588783 AGAAAGAAGTAGAATAAAGTGGG - Intergenic
1175459502 20:59141657-59141679 TTTGAAAAGGAGAATAAAGTTGG - Intergenic
1175686852 20:61036855-61036877 AGAGAGAAGGACAATGCTGTAGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176940917 21:14924629-14924651 CTAGAGAAGAATATTGAAGTTGG + Intergenic
1177350473 21:19933373-19933395 CTAGAGAGCGAAAATGAAGTAGG - Intergenic
1177444576 21:21175671-21175693 ATAGAAAATGAGAATGAATCAGG + Intronic
1177531264 21:22360994-22361016 AGAGAGATGTAGAATAAAGTGGG + Intergenic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1177972117 21:27803037-27803059 CTAGAGAAAGAGAATGGAGAGGG - Intergenic
1178717919 21:34983771-34983793 AAGGAAGAGGAGAATGAAGTTGG + Intronic
1179009665 21:37546543-37546565 AGAAAGAAGGAGAATGAAATAGG + Intergenic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1181497771 22:23297534-23297556 ATGGAGAGGGAGAGAGAAGTGGG - Intronic
1182344154 22:29648620-29648642 AAAGAAAAAGAAAATGAAGTGGG - Intronic
1182795361 22:32987700-32987722 ATAGAGAAGGAGATTTTTGTGGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182920170 22:34072072-34072094 ACAGACAGAGAGAATGAAGTGGG + Intergenic
949692510 3:6656043-6656065 AGAGAGAGAGAGAATGAAGGGGG + Intergenic
951430285 3:22598199-22598221 AGAGAGAAAGAGAGTGAAGTGGG - Intergenic
951504400 3:23426749-23426771 AGAGAGAAGGAAAATGACATAGG + Intronic
951745241 3:25970998-25971020 AGAGAAAAGGAAAATGAAGAGGG - Intergenic
952111529 3:30129377-30129399 AGAGTGGAGGAGAATGAAGTTGG - Intergenic
952185532 3:30963825-30963847 ATAGAGAGAAAGGATGAAGTTGG - Intergenic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
952667561 3:35925077-35925099 ATAAAGAATGAGAATTAAGAAGG - Intergenic
953256037 3:41291423-41291445 AGAGAGAAGGAGAGAGAAGGAGG + Intronic
953809731 3:46101739-46101761 ACAGAGGAGGAAAATGAAGCTGG - Intergenic
953891318 3:46753604-46753626 ATTGAGAAGGAGTGGGAAGTTGG + Intronic
953896800 3:46809272-46809294 ATTGAGAAGGAGTGGGAAGTTGG + Intronic
953985288 3:47437438-47437460 AAAAAAAAGGAGAATAAAGTTGG + Intronic
954050806 3:47975480-47975502 ATAGAGAGGGAGGAAGAAGTAGG + Intronic
955033860 3:55247606-55247628 AAAGAGAAGGAGAAAGGAGGAGG - Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
956279832 3:67544432-67544454 GGAGAGAAAGAGAGTGAAGTGGG - Intronic
956343450 3:68251554-68251576 AAAGTGAAGGAGAAAGAAGAGGG + Intronic
956812572 3:72878420-72878442 AGAGAGAAGGAAAATGATGTAGG - Intergenic
956906036 3:73766348-73766370 ATAGAGATTGAGTATCAAGTGGG + Intergenic
957016966 3:75077711-75077733 AGAGAGAAGGAAAATGATATAGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957922815 3:86768605-86768627 ATTAGGAAGGAGAAAGAAGTTGG + Intergenic
957981294 3:87514767-87514789 AGAAAGAATGAGAATGAAGTTGG - Intergenic
958648686 3:96906963-96906985 ATAATGAAGGAGAATGGAATGGG + Intronic
959369376 3:105504463-105504485 AGCCAGAAGGAGGATGAAGTGGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
960380064 3:116948886-116948908 ATAAGGAAGGAGAGTGAATTTGG - Intronic
960419350 3:117424947-117424969 AAAGAGAGGGAGAATCAAGATGG + Intergenic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
961341882 3:126229483-126229505 ATACTGAAGAAGAATGAAGTTGG - Intergenic
961806985 3:129496546-129496568 ATAGAAAAGCAGAAAAAAGTGGG - Intronic
962069301 3:132016703-132016725 ATAGAGAAGGAGAGTAAACTAGG - Intronic
962674571 3:137745272-137745294 ATAAAGAAGGAGAAAGAATGAGG + Intergenic
962764588 3:138549602-138549624 ATAGAGAAGGACCATCATGTTGG - Intronic
963177085 3:142310481-142310503 ATATAGAATCAGAATGAAATAGG + Exonic
963443062 3:145365749-145365771 ATAGATAAGAAGACTGAAATGGG - Intergenic
964605174 3:158553173-158553195 AAAAAGAAGGAGAAAGAATTGGG + Intergenic
964677833 3:159303497-159303519 ATAGAGAGGGAGAGGGAAGAAGG + Intronic
964891481 3:161541268-161541290 ACAGAGATGGAGAAGCAAGTGGG - Intergenic
965046237 3:163581661-163581683 AGAGAGAAAGAGAATTAAGAGGG + Intergenic
965775065 3:172220705-172220727 ATAGACAAAAAGAATGAACTTGG - Intronic
966098451 3:176236298-176236320 ATGAAGAAGTAGAATGCAGTAGG + Intergenic
966189323 3:177257879-177257901 ATAGAAAACAAGAAGGAAGTTGG - Intergenic
966559861 3:181308184-181308206 ATAAGGAAGGAGAATGAGCTAGG + Intergenic
966577597 3:181519889-181519911 AGAGAGATGGAGAATGAAGCTGG - Intergenic
967998885 3:195187590-195187612 ATACAGAAGGGGAAAGAAATGGG + Intronic
968534855 4:1118079-1118101 AGAAAGAAGGAAAATGATGTAGG + Intergenic
969828176 4:9774806-9774828 GGAGAGAAAGAGAAAGAAGTAGG - Intronic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970389829 4:15597208-15597230 AGAGAGAAGAAAAATGAAATTGG + Intronic
970502423 4:16691534-16691556 AGAGAGAAGGAGATGGAAGCAGG + Intronic
971143676 4:23952281-23952303 GCAGAGAAGGAGAATGGAATGGG - Intergenic
971577799 4:28298988-28299010 AGAGAGAAGGAAAATGATATAGG - Intergenic
971865670 4:32168299-32168321 AAAGAGGAGGAGAAAGAAGAAGG - Intergenic
972200328 4:36706837-36706859 ATAGAAAAGAAGCATAAAGTTGG + Intergenic
972291732 4:37695947-37695969 AGAGAGAAAGAGAAAGAAGGGGG - Intergenic
972602555 4:40585975-40585997 ATAGAGAAGGAGCTTGGTGTTGG - Intronic
972645326 4:40962703-40962725 AAAGAGGAGGACAAAGAAGTGGG + Intronic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
974449581 4:62035853-62035875 ATAGATAAGGAGATTGAAATGGG - Intronic
974488936 4:62539058-62539080 AGAGAGAAGGAAAATTATGTAGG + Intergenic
974492408 4:62584184-62584206 ATAGATAAGGAGATGGAAATGGG + Intergenic
974649754 4:64739984-64740006 ATAGAGTAGACGAATGGAGTAGG - Intergenic
975559066 4:75692730-75692752 ATCAACAAGGAGAATGAAATTGG + Intronic
975651942 4:76602017-76602039 AGAGAGCAGAAGAACGAAGTTGG + Intronic
975690278 4:76956305-76956327 ATAGAGAAGGAAAATGAGACAGG + Intronic
975835147 4:78415085-78415107 AGAGGGAAGGAGTAGGAAGTGGG - Intronic
976312796 4:83628986-83629008 ACAGAGGAAGAGAATGAATTTGG - Intergenic
976599955 4:86928903-86928925 AGAGAGAAGGAGAGGGAAGGAGG - Intronic
976995568 4:91428574-91428596 GTAGAGAAAGAAAATCAAGTTGG - Intronic
977155179 4:93563015-93563037 ATACTGAAGAAGAATAAAGTTGG - Intronic
977370420 4:96127195-96127217 ATAGAGAAGGAAAGGGAAGAAGG - Intergenic
977491068 4:97712146-97712168 TTAGAGAATTAGAATGAAATAGG - Intronic
977818794 4:101447454-101447476 CTAGAGAAGCAGGATGCAGTAGG + Intronic
978003029 4:103580081-103580103 ATAGGGAAGGAGAAACAAGGTGG - Intergenic
978157454 4:105506095-105506117 ATTGAGAAGGAGCATGTTGTGGG - Intergenic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978449422 4:108814837-108814859 ATAGGGAAGGAGAATAACGGAGG + Intronic
978595904 4:110376896-110376918 AAAAAGAAGGAGAAAGAAGGAGG - Intronic
978651152 4:111006795-111006817 AGAGAGAGTGAGAATGAAGTAGG - Intergenic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
979352674 4:119663528-119663550 ATTGAGAAGGAGAATGGCTTTGG + Intergenic
979743910 4:124185625-124185647 AAAGAAAAGAAGAATGAATTTGG - Intergenic
979860743 4:125690605-125690627 ATAAAGAAGGATACTGATGTAGG - Intergenic
980434143 4:132747282-132747304 ATACAGAAGGAAAATAATGTAGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981358961 4:143825654-143825676 AAGGAGAAGGAAAACGAAGTTGG + Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981563535 4:146073724-146073746 CCAGAGAAGTAGCATGAAGTAGG - Intergenic
981793846 4:148571746-148571768 ATAGAGAAGGTGAAAGCATTTGG + Intergenic
981955570 4:150469052-150469074 AATCAGAAGGAGAAGGAAGTGGG - Intronic
982267416 4:153551335-153551357 GCAGTGAAGGAGAATGAACTTGG + Intronic
982797393 4:159662883-159662905 GGAGAGAGGGAGAATGAGGTGGG + Intergenic
982967990 4:161939029-161939051 ACAGAGAAAGAGAATGACATTGG + Intronic
983112731 4:163772916-163772938 ATATGGAAGGAGAAGGAGGTGGG + Intronic
983118928 4:163856218-163856240 ATAGAAAACTAGAATGCAGTTGG - Intronic
983430057 4:167638070-167638092 AGAGAGAAGGAAAATGATATAGG - Intergenic
983518349 4:168679684-168679706 ATAGAGGTAGAAAATGAAGTTGG + Intronic
983641674 4:169949132-169949154 ATAGAGAAGGGGAAAGAAAGTGG - Intergenic
983732240 4:171010436-171010458 AGAGAGCAAGAGAATGAGGTGGG - Intergenic
983915756 4:173289016-173289038 AGAAAGAAGGAAAATGCAGTAGG + Intronic
984310250 4:178049164-178049186 ATTGAGAAGGGTAGTGAAGTAGG - Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
984620501 4:181946814-181946836 ATAAAAAAGGATAATCAAGTCGG + Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984740125 4:183153311-183153333 ACAGAGTAGGAGATTCAAGTAGG + Intronic
984743661 4:183192299-183192321 AAAGAGAAGGAAACTGAAGTAGG + Intronic
984824566 4:183913137-183913159 ATGGAGAAGGAGAAGGATTTGGG + Intronic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
985085007 4:186304192-186304214 ATGGAAAAAGAGAATTAAGTTGG - Intergenic
985115392 4:186585043-186585065 ATAGACAAAGAGAAAGAAGCAGG + Intergenic
985118758 4:186618299-186618321 ACAGAGCGGGAGACTGAAGTTGG - Exonic
985167741 4:187115453-187115475 AGAGGGATGGAGAAGGAAGTAGG + Intergenic
985179466 4:187240917-187240939 ATAGAAAAGGAGAGAGAAGCTGG + Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985992277 5:3573243-3573265 ACAGAGAAGGAAAATAAAGAGGG + Intergenic
986603784 5:9501481-9501503 ATACAGAAAGAGCATTAAGTGGG + Intronic
988089614 5:26519699-26519721 AGAAAGAAGGAGAAGGAAGAAGG + Intergenic
988689556 5:33558923-33558945 ATATAGAAAGAGAAAGAAGGTGG + Intronic
989110925 5:37905978-37906000 AGAGAGTGGGAAAATGAAGTAGG - Intergenic
989129836 5:38096303-38096325 CTAGTGAAGCAGAATGCAGTTGG - Intergenic
989345504 5:40425032-40425054 TTAGAGAAGGAGAAAGAGTTTGG - Intergenic
989411912 5:41129308-41129330 ATAGAGAGAGAGAAAGAAGAAGG - Intergenic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
990061000 5:51648326-51648348 AGAAAGATGGAGAATGAATTTGG - Intergenic
990122034 5:52466782-52466804 AGAGAGAAAGAGAAAGAAGATGG - Intergenic
990571171 5:57080362-57080384 AGAGAGAAGGAAAATAATGTAGG - Intergenic
990649769 5:57885160-57885182 ACAGAGTTGGAGAATGAAGCAGG + Intergenic
990729793 5:58795826-58795848 ATAGAGAAAGAGAAAAAAGCAGG + Intronic
990771127 5:59246947-59246969 TTATAGAATGAGAATGAACTAGG + Intronic
991716666 5:69457277-69457299 ACTGAGAAGGAGAATGACATGGG + Intergenic
991731081 5:69588879-69588901 ACTGAGAAGGAGAATGACATGGG + Intronic
991807513 5:70444038-70444060 ACTGAGAAGGAGAATGACATGGG + Intergenic
991863869 5:71038973-71038995 ACTGAGAAGGAGAATGACATGGG - Intronic
992013302 5:72552283-72552305 AAAGCCAATGAGAATGAAGTTGG + Intergenic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992536612 5:77711751-77711773 ATAGACAAGCACAATGAAGTAGG - Intronic
992552183 5:77869361-77869383 ATAAAGAAGGAGAATCAATAGGG - Intergenic
992571518 5:78064080-78064102 AAAAAAAAGGAGCATGAAGTAGG + Intronic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
992958039 5:81930498-81930520 TTAGAGAAAGAGAAGGGAGTAGG - Intergenic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
994285032 5:97954770-97954792 AGAGAGAGAGAGAATGAAGGAGG - Intergenic
995435487 5:112130149-112130171 AAAGAGAAAAAGAATAAAGTGGG + Intergenic
995892603 5:116972327-116972349 AAAGAAAAAGAGAATGAAGGAGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996642353 5:125771099-125771121 TTAGAGCAAGAGAATGATGTCGG - Intergenic
996754480 5:126921489-126921511 CTAGACAAGGAAAATGCAGTGGG - Intronic
997017834 5:129957885-129957907 AGAAAGAATAAGAATGAAGTTGG - Intronic
997292097 5:132744822-132744844 AGAGAGAAGGAAAATGATATAGG - Intergenic
997354312 5:133252589-133252611 ATAGAGAGGGGGAATGCAGGTGG + Intronic
997354925 5:133256245-133256267 ATTTAGAAGGAGAATAATGTGGG - Intronic
998559945 5:143161966-143161988 ATAGAAAAGGAGAATGAAATTGG + Intronic
999104585 5:149059791-149059813 AGAGAGAAGGAGAATGAGATTGG + Intronic
999376753 5:151092113-151092135 GAAGAGAAGGAGAAGGAAGTGGG + Intronic
999691343 5:154148596-154148618 ATACAGTAGTTGAATGAAGTAGG - Intronic
999813960 5:155157003-155157025 GAAGTGAAGGAGGATGAAGTAGG - Intergenic
1000054041 5:157588248-157588270 ATATTGAAGGAGAACGAAGTTGG - Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000724905 5:164757812-164757834 AAACAGAAGAAGAATAAAGTTGG - Intergenic
1001185707 5:169569668-169569690 ATAGCGAAGGAAAATGACGTGGG - Intergenic
1001210913 5:169809474-169809496 AGAGCGGAGGAGAAGGAAGTGGG - Intronic
1001228048 5:169962722-169962744 AGAGAGAAAGAGAAGGAAATAGG + Intronic
1001307230 5:170584327-170584349 TTAGAGAAGGGGATTGGAGTAGG + Intronic
1001427939 5:171636621-171636643 ATGGAGAAGGAATATGTAGTAGG + Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1002174706 5:177395183-177395205 ATAGAAAAAGAAAATGAATTAGG + Intronic
1002733314 5:181360001-181360023 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1002751226 6:114117-114139 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1002760120 6:195198-195220 ATAGATTAGAAGAATAAAGTTGG + Intergenic
1002953081 6:1835057-1835079 ATAGAGAGGGAGAGGGAAGGAGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003624939 6:7732771-7732793 TTAGACAAGGAAAATGAAGAGGG + Intronic
1003711905 6:8602298-8602320 ATAGGGAAGGACCATCAAGTGGG + Intergenic
1004025388 6:11813294-11813316 AAAGAACAGCAGAATGAAGTCGG + Intergenic
1004392346 6:15220397-15220419 CAAGAGAAGGAAAAGGAAGTTGG + Intergenic
1004398372 6:15266369-15266391 AAAGAGAAAGAGAAGGAATTTGG - Intronic
1004443236 6:15673502-15673524 TTAAAGAAGTAGAAAGAAGTGGG + Intergenic
1004705277 6:18118656-18118678 AGGGAGAAGGAGAAGGAAATAGG - Intergenic
1004799068 6:19125532-19125554 ATATGGAAGGAGAACAAAGTTGG + Intergenic
1004986748 6:21091422-21091444 TTTGAAAGGGAGAATGAAGTAGG + Intronic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005797621 6:29383462-29383484 TTACAGTTGGAGAATGAAGTTGG + Intronic
1006137732 6:31906119-31906141 AAGGAGAAAGAGAAAGAAGTTGG - Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006703689 6:35998171-35998193 ATAGAGAAGTTGACTGAAATGGG + Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007716695 6:43860282-43860304 AGGGAGAGGGAGAAGGAAGTGGG + Intergenic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1008410710 6:51175347-51175369 TTAGAGAATGAGAATGACATGGG - Intergenic
1009184248 6:60554837-60554859 AAAGAGAAAGGGAAGGAAGTTGG - Intergenic
1010561684 6:77358870-77358892 ATAAAGAAGGAGACTAAAGAAGG + Intergenic
1010657607 6:78530276-78530298 ACAGGAAAGGAGAATGAAGTGGG - Intergenic
1010825800 6:80473269-80473291 ATAGACATGGAAAATAAAGTAGG - Intergenic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1010908008 6:81516848-81516870 AAGGAAAAGGAGAATGGAGTGGG + Intronic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011233335 6:85188015-85188037 ATAGGGAAGGACCATCAAGTGGG - Intergenic
1012493073 6:99804147-99804169 TTAGAGAAGGCCGATGAAGTTGG + Intergenic
1012517171 6:100075795-100075817 CTAGAGAAAGAGAAGGAACTGGG + Intergenic
1012619223 6:101319377-101319399 ATACTGAAGAAGAATAAAGTTGG - Intergenic
1012693309 6:102345759-102345781 ATATATAAGGAGTAAGAAGTTGG + Intergenic
1012936133 6:105369507-105369529 ATACAGAAGGAGAACAAAGTTGG + Intronic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013286001 6:108682346-108682368 ACAGATCAGGAGAATGAAGAGGG + Exonic
1013670456 6:112396702-112396724 ATAAGAAAGGAGAATGAGGTTGG - Intergenic
1013721026 6:113028316-113028338 AGAGGGAAGGACCATGAAGTGGG + Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014178558 6:118357377-118357399 AGAGAGAAGGAAAATGATATAGG + Intergenic
1014313634 6:119836464-119836486 ATAGAGAAAGAAAAGGAAGGGGG - Intergenic
1014687157 6:124515688-124515710 AAAGCGAAGAAAAATGAAGTAGG - Intronic
1015160211 6:130144542-130144564 AAAGAAAAGGAAAACGAAGTAGG - Exonic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015288942 6:131516059-131516081 ACACAGAAGAAGATTGAAGTTGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015743430 6:136483756-136483778 ATAGAAATGGAGAAGGGAGTAGG - Intronic
1016405392 6:143724497-143724519 AAAGGGAAGGTGAAAGAAGTTGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017397419 6:154018467-154018489 ATAGAAAATGAGAAAGAACTTGG - Intronic
1017651973 6:156591952-156591974 ATAAAGAATAGGAATGAAGTGGG + Intergenic
1018035126 6:159875211-159875233 GTAGGGGAGGAGAATGAAATAGG + Intergenic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1018468424 6:164074024-164074046 AAAGAGACAGAGAAGGAAGTGGG + Intergenic
1018556556 6:165057083-165057105 ACAGAGAAGGAAAATGATATAGG + Intergenic
1018943194 6:168324425-168324447 AAGGAGAAGGAGAAGAAAGTAGG - Intergenic
1018998843 6:168730090-168730112 AGAGAGAAGGAGAAGAAAGGAGG - Intergenic
1019237564 6:170632323-170632345 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019800509 7:3084819-3084841 AAAAAGAAGGGGAATGGAGTGGG - Intergenic
1021373946 7:19883793-19883815 ATAGAAAAGAAGAATGAGATTGG - Intergenic
1021410156 7:20320933-20320955 GATGAGAAGAAGAATGAAGTAGG + Intergenic
1021450557 7:20779647-20779669 AGAGAGAAGGATAAAGATGTTGG + Intergenic
1021586476 7:22214259-22214281 TTAGAAAAGGGGAAGGAAGTAGG + Intronic
1021796548 7:24260554-24260576 ATAGAAAATGAGCATGAAATAGG + Intergenic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022532066 7:31073334-31073356 AGAGAGAGGGAGAAGAAAGTGGG + Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023267895 7:38427744-38427766 ATAGTGATGGATAATGAAGTAGG + Intronic
1023528414 7:41129271-41129293 AGAGAGAAAGAGAAAGAGGTTGG - Intergenic
1024130506 7:46347868-46347890 ATAGAGAAGAAGATGGAAATTGG + Intergenic
1024432494 7:49305445-49305467 ATAGTGCAGAAGAATGAAATTGG - Intergenic
1024752871 7:52489288-52489310 ATAGAAGACGAGACTGAAGTTGG + Intergenic
1024824178 7:53370175-53370197 ATAAAGACAGAGAATGAAGGTGG + Intergenic
1026062932 7:67042544-67042566 ATAGAGAAGGAAGATGGGGTAGG + Intronic
1026104170 7:67407903-67407925 ACACAGAAGGAGAAGGAAGTGGG - Intergenic
1026193346 7:68149738-68149760 AGAGAGATGGAGAATGAGGGTGG + Intergenic
1026531658 7:71204101-71204123 ATCCACAAGCAGAATGAAGTCGG - Intronic
1026552893 7:71382758-71382780 CTAGAGAAAGAGAAGGAATTGGG + Intronic
1026715417 7:72784946-72784968 ATAGAGAAGGAAGATGGGGTAGG - Intronic
1027352987 7:77330554-77330576 AAAGAGACAGAAAATGAAGTGGG - Intronic
1027559616 7:79711690-79711712 ATAGATAAGGAAAATAAATTCGG + Intergenic
1027630881 7:80604128-80604150 CTAGAGGAGGGGAATGAGGTTGG + Intronic
1027799256 7:82731727-82731749 ACATAGAAGGATAATGAATTTGG - Intergenic
1027907997 7:84211289-84211311 AAAGAGGAGGATAAAGAAGTGGG + Intronic
1028009783 7:85627048-85627070 TTAGAGAAGAAAAATAAAGTTGG + Intergenic
1028401830 7:90433111-90433133 CTAGACAAGGGGAATGCAGTGGG + Intronic
1028865962 7:95712227-95712249 AGAGAGAAGGAAAATGATATAGG + Intergenic
1029405709 7:100373155-100373177 AGAGAGGAGGAGAAGGAAGCCGG - Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1030015282 7:105213204-105213226 ATAGAGCAGGTGGATGAAGAAGG + Intronic
1030176839 7:106662387-106662409 TTAAATAAGGAGAATGAACTAGG - Intergenic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1031713086 7:125073667-125073689 ATAGATAAAGAAAATGAGGTTGG + Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032484642 7:132276274-132276296 AGAGAGAATGAGAAGGAAGGTGG - Intronic
1032924498 7:136588122-136588144 ATAGCAAAAGAGAATGAATTGGG - Intergenic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1034230522 7:149523411-149523433 ATGAAGAAGGAGAACAAAGTTGG + Intergenic
1034721964 7:153301630-153301652 ATAGAGAAGAAGGCTGAATTGGG + Intergenic
1035510203 8:174288-174310 CTAGAGAAGGAGGATGCAGCAGG - Intergenic
1036938617 8:13030235-13030257 ATAGAAAAGGAGCATGAAGATGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038161964 8:25048158-25048180 ATAGAGAGGGAACATGAAGATGG + Intergenic
1038512279 8:28150334-28150356 AGAGAGAAGGAAAATGATATGGG - Intronic
1038698096 8:29824260-29824282 AAAAAGAAGAAGAAGGAAGTGGG + Intergenic
1039179626 8:34851142-34851164 AGAGAAGAGGAGAAAGAAGTGGG - Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040593588 8:48817997-48818019 ATAGAGAAAGAAAAAGAAGGGGG - Intergenic
1040729944 8:50432458-50432480 ATACTGAAGAAGAATAAAGTTGG - Intronic
1041212088 8:55562391-55562413 ACAGAGAAGGAAAATGATATAGG - Intergenic
1041293733 8:56333397-56333419 ATAGAGAAGGACCATCAGGTGGG + Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1042505569 8:69556172-69556194 GTAGAGAAAGAGAAAGAAATGGG + Intronic
1042582111 8:70291554-70291576 ACAGACAAGTAGAATGATGTTGG - Intronic
1042655350 8:71089687-71089709 TTAGATGAAGAGAATGAAGTTGG - Intergenic
1042703034 8:71637557-71637579 AGAGAGAAATAGAATAAAGTAGG - Intergenic
1043197370 8:77313916-77313938 AAAGAGGAGGAGAAAGTAGTAGG - Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1043970197 8:86520030-86520052 ATAGAGATGGAGACTGAGTTTGG + Intronic
1044014214 8:87030961-87030983 AGAAAGAAGGAGAAAGAAGGGGG - Intronic
1044068620 8:87727544-87727566 AGAGAGAAGAAGAATGAAGGAGG - Intergenic
1044187837 8:89277710-89277732 AGAGAGAAAGAGAAAGAAGGGGG - Intergenic
1044844603 8:96367672-96367694 ATAGACATGGAGAATGGAGGAGG - Intergenic
1045371904 8:101532838-101532860 AGAGAGAAAGAGAAAGAGGTGGG + Intronic
1045587830 8:103559217-103559239 AAAAAGAAGAAGAAGGAAGTGGG - Intronic
1045778970 8:105841245-105841267 AAGGAGAAGGGGAATGAAGGAGG - Intergenic
1046732057 8:117736502-117736524 GAAGAGGAGGAGAATGAAGATGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046830603 8:118741658-118741680 AAAAAGAAGGAAAATAAAGTAGG - Intergenic
1046854369 8:119014196-119014218 AAAGAAAAGGTAAATGAAGTAGG - Intronic
1046884443 8:119348680-119348702 ATATTGAAGAAGAGTGAAGTTGG - Intergenic
1047168233 8:122464289-122464311 ATAGGGAGGGAGTAAGAAGTGGG - Intergenic
1047628472 8:126680664-126680686 CTAAAGAAACAGAATGAAGTGGG - Intergenic
1047663385 8:127063199-127063221 ATAGAGAAGTAGATCGAAATAGG + Intergenic
1047733810 8:127748396-127748418 ATAGAGAAAGAGAATTAAACAGG - Intergenic
1047906505 8:129478859-129478881 ACAGAGAAGTTGGATGAAGTTGG + Intergenic
1048067027 8:130980454-130980476 AGAGAAATGGAGAAGGAAGTAGG + Intronic
1048072514 8:131037647-131037669 AAAGAGAAGGAAAAAGAAGGAGG + Intronic
1048081479 8:131132874-131132896 AGAGAGGTGGAGAATGAACTGGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048374630 8:133812500-133812522 ATAGACAAGCAGAGAGAAGTGGG - Intergenic
1049051084 8:140197151-140197173 AAAGAGGAGGAGAATAAAGTGGG + Intronic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1050055041 9:1643380-1643402 ATATTGAAAGAGAACGAAGTTGG - Intergenic
1050141012 9:2515585-2515607 ATAAAGAAGGAGAACAAAATTGG - Intergenic
1050213066 9:3286774-3286796 TTACAGAAGGAGAATCAAGGAGG - Intronic
1050384475 9:5072437-5072459 GTAAAGATGGAGAACGAAGTAGG - Intronic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1050642841 9:7686752-7686774 ACAGAGAAGGAGAATGACATAGG + Intergenic
1050648514 9:7748656-7748678 ATAAAGACGGAAAATGAAGCAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051693869 9:19747212-19747234 AGAGAGAAGTGGAATGAAGAGGG - Intronic
1051961964 9:22777163-22777185 ATAAAGGAGAAGAATAAAGTTGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052876136 9:33566180-33566202 ATAGAGCTTGATAATGAAGTAGG - Intronic
1053499878 9:38578165-38578187 ATAGAGCTTGATAATGAAGTAGG + Intergenic
1053518058 9:38748448-38748470 AATGAGAAGGAAACTGAAGTTGG - Intergenic
1054879917 9:70134329-70134351 AAAGGGATGGAGAAGGAAGTGGG - Intronic
1055729161 9:79262951-79262973 AGAGAGAGAGAGAGTGAAGTGGG - Intergenic
1055856523 9:80694534-80694556 AAAGAGAAGGAGACAGGAGTAGG + Intergenic
1056197330 9:84240940-84240962 AGAGAGAAGGAAAGTGAGGTTGG + Intergenic
1056401968 9:86236664-86236686 AGAGAGAAGGATAATCATGTAGG + Intronic
1056458909 9:86790532-86790554 AGAGAGAAGGAGAATGATTCGGG + Intergenic
1057679302 9:97162863-97162885 ATAGAGCTTGATAATGAAGTAGG + Intergenic
1058398302 9:104582001-104582023 TTACAGAAGGAGAATGACTTTGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059269515 9:113063074-113063096 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059270647 9:113068521-113068543 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059271782 9:113073968-113073990 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059272916 9:113079415-113079437 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059274051 9:113084857-113084879 CTAGAGAAGGACAAAGGAGTGGG + Intergenic
1059396249 9:114035776-114035798 ACAGAGAAGCAGGAGGAAGTGGG - Intronic
1059540577 9:115126431-115126453 ACAGAGAAGGAAAGGGAAGTTGG + Intergenic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1060328276 9:122640144-122640166 GTAAAGAAGGAAAATGAAGAAGG - Intergenic
1062504186 9:136865041-136865063 AAAGAAAAGGAGAGTGAATTTGG + Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062757718 9:138312313-138312335 CTAGAGAAGGAGGATGCAGCAGG + Intergenic
1185604537 X:1360415-1360437 AAAGAGAGGGAGAATGAAAGAGG - Intronic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1186175581 X:6922782-6922804 GTAGAGAAGGAGAGAGAAGCTGG - Intergenic
1186424837 X:9455694-9455716 AAAGAGAAGGAGAAAGGAGGAGG - Intergenic
1186846096 X:13532526-13532548 ATAGAGAAGCAGGATAAACTGGG + Intergenic
1187003337 X:15205214-15205236 ATAGGGAAGGAGGAGGAATTGGG + Intergenic
1187141085 X:16594256-16594278 TTAGAGATGGGGAAGGAAGTGGG - Intronic
1187146469 X:16641862-16641884 GGAGAGAAGGAAAATGCAGTGGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187704183 X:21993286-21993308 ATCGAGAACTAGAATGATGTTGG + Intronic
1187748397 X:22433733-22433755 ATAGGGAAGGAGCATCAGGTGGG - Intergenic
1187944388 X:24412146-24412168 AAAGAGCAGGGGAATGAAGAAGG - Intergenic
1188165090 X:26852600-26852622 ACAGAGAAGGAGATTATAGTGGG - Intergenic
1188629752 X:32339870-32339892 TTAGAGAAGGAGAATATAGGGGG + Intronic
1188735570 X:33710407-33710429 AGAGAGAAGAGGAAAGAAGTAGG + Intergenic
1188800890 X:34528158-34528180 GGAGAGAAAGAGAATGAAGGGGG - Intergenic
1189013757 X:37074137-37074159 AAAAAGAAAGAGAATGAAGCTGG + Intergenic
1189218179 X:39345094-39345116 ATAGGGAAGGAGCATCAGGTGGG - Intergenic
1189609167 X:42713773-42713795 AGATAGGAGGGGAATGAAGTAGG + Intergenic
1189898616 X:45682601-45682623 ATAGAGGTGGAGGATGGAGTTGG - Intergenic
1192029628 X:67495433-67495455 GGAGAGAGGGAGAATGAAGGGGG - Intergenic
1192381090 X:70617261-70617283 AGAGAGAAGGAAAATGATATAGG + Intronic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1193077024 X:77365058-77365080 ATAGAGAAGGACCATCAGGTGGG - Intergenic
1193207118 X:78762156-78762178 ATAGACAAGTAGCATGCAGTAGG + Intergenic
1193315025 X:80055135-80055157 ATAGAGAAAGAGTATCACGTAGG + Intergenic
1193448154 X:81631029-81631051 ATAAAAGAGAAGAATGAAGTGGG - Intergenic
1193633121 X:83914350-83914372 ATAGAAATGGAGAATGGAATAGG + Intergenic
1193677007 X:84467011-84467033 AAAGAGTAGGTGAATGAAGGAGG + Intronic
1193763818 X:85500633-85500655 AAAGAGAAGGAGAATGAGTTTGG + Intergenic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1194077222 X:89411154-89411176 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1194079434 X:89440496-89440518 ACTGAGAAGGAGAAAGCAGTTGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194858290 X:98961561-98961583 AAAGGGATAGAGAATGAAGTGGG + Intergenic
1194972233 X:100356749-100356771 AGAGAGAGAGAGAATGAATTAGG - Intronic
1195521970 X:105841400-105841422 AAAGAGAGGGAAAATGAAGTGGG + Intronic
1195542912 X:106083845-106083867 ATTGAAAAAGAGAATCAAGTGGG - Intergenic
1195676423 X:107510629-107510651 TCAGAAAAGGGGAATGAAGTTGG - Intergenic
1196188347 X:112768945-112768967 ACAAAGTAGGAGAATGGAGTAGG + Intergenic
1196211929 X:113005495-113005517 ATAGACCAGTAGAATGAACTGGG + Intergenic
1196313026 X:114190506-114190528 AGAGAGAAAGAAAATGATGTAGG + Intergenic
1196371337 X:114982888-114982910 CTAGAGAAGGACAGTGAAATGGG - Intergenic
1197834632 X:130681540-130681562 AGAGAGAAGGAACATGAACTTGG + Intronic
1197853085 X:130885198-130885220 CTAGAGAAGGAGGATAAATTTGG - Intronic
1198589938 X:138167171-138167193 ATAGGGAAGGAAAATAAAGCAGG - Intergenic
1198712060 X:139515215-139515237 ATACTTAAGAAGAATGAAGTTGG - Intergenic
1198791355 X:140350188-140350210 GTAGAGAAGAAAAATGAAGCAGG - Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199172279 X:144745639-144745661 AAAGAGAAGGAGTGTGCAGTAGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199506365 X:148566256-148566278 ATAGGGAAAGAGAATGAGCTTGG - Intronic
1199521497 X:148741241-148741263 ATAGAGAAGGACCATCAGGTGGG + Intronic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1200175588 X:154113608-154113630 AAAGAGAAGGACAATGACATAGG - Intergenic
1200429868 Y:3066699-3066721 TTAGGGAAAGAGAAGGAAGTTGG - Intergenic
1200432052 Y:3095801-3095823 ACTGAGAAGGAGAAAGCAGTTGG + Intergenic
1201306711 Y:12556710-12556732 ATAGGGAAGGACCATGAGGTGGG - Intergenic
1201490208 Y:14532809-14532831 ATAGAGAAAAAGAAGGAAGGAGG - Intronic