ID: 1107071647

View in Genome Browser
Species Human (GRCh38)
Location 13:36276624-36276646
Sequence GGGTGTAGTGGAGGACAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107071636_1107071647 -1 Left 1107071636 13:36276602-36276624 CCCTGAAGGATCCAAGCTGCCTG 0: 1
1: 0
2: 1
3: 11
4: 172
Right 1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG 0: 1
1: 0
2: 4
3: 32
4: 369
1107071637_1107071647 -2 Left 1107071637 13:36276603-36276625 CCTGAAGGATCCAAGCTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG 0: 1
1: 0
2: 4
3: 32
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107071647 Original CRISPR GGGTGTAGTGGAGGACAAGG GGG Intronic
901163248 1:7196491-7196513 GGGTGTGGTGGAGCACAGCGTGG + Intronic
901301372 1:8201987-8202009 TGGTGTCCTGCAGGACAAGGTGG - Intergenic
901441800 1:9282537-9282559 GGGAGAGGAGGAGGACAAGGAGG - Intergenic
901786118 1:11626056-11626078 GGATGTGGTGGAGGAGATGGTGG + Intergenic
902188523 1:14743716-14743738 GGGAGTAGTGGAGGGTGAGGAGG - Intronic
903570994 1:24304808-24304830 AGGTGTAGGGGAGGACAAGGAGG + Intergenic
904463872 1:30696711-30696733 GGGTGTCCTGGAAGAGAAGGAGG + Intergenic
904464367 1:30699076-30699098 GGGTGTCCTGGAAGAGAAGGAGG + Intergenic
904509211 1:30988700-30988722 GAGTGTACAAGAGGACAAGGAGG - Intronic
904875476 1:33651545-33651567 GGGTGTAGGGGAAGAAGAGGAGG + Intronic
904944595 1:34189966-34189988 AGGGGAAGTGGAGGACAGGGAGG + Intronic
905441771 1:38000522-38000544 GGGTGGGGAGTAGGACAAGGGGG + Intronic
905968229 1:42117180-42117202 GGGTGTCCTGGAAGCCAAGGGGG + Intergenic
906812757 1:48845987-48846009 TGGTCTAGTGGAGGCCAATGTGG + Intronic
906935506 1:50210969-50210991 GGGTGAAGTGGAAGTAAAGGGGG + Intergenic
906952767 1:50348212-50348234 GGGTGTGGTAGAGGAATAGGTGG - Intergenic
909847421 1:80412449-80412471 GGAGGTGGTGGAGGAAAAGGAGG + Intergenic
912314043 1:108650626-108650648 GGGTGTAGGGGTGGACAAGGAGG + Intronic
912354552 1:109043889-109043911 AAGTGTAGTGGAGGGCAAAGGGG + Intergenic
912466411 1:109877753-109877775 GGGTGTGCTGGAGGACAGGCGGG + Intergenic
912624801 1:111198063-111198085 GGGTGGAGAGGAGGGCAAAGGGG + Intronic
912972697 1:114298961-114298983 GGTTGGAGTGGAGGTCAAGGAGG - Intergenic
915388802 1:155521683-155521705 GGGTATAGGGGAAGACAAGGAGG + Intronic
915464596 1:156089539-156089561 GAGTGCAATGGAGGCCAAGGCGG - Intronic
915725487 1:158014141-158014163 GGGGGAAGTGGAGGGCAACGAGG + Intronic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
918388544 1:184036171-184036193 GTGGGTTGTGGAGGACAAGGAGG - Intronic
918704272 1:187641312-187641334 GGGTGAAGAGGAAGAAAAGGGGG - Intergenic
919073823 1:192790060-192790082 GGGTAGAGTGGGTGACAAGGAGG + Intergenic
919742740 1:200990540-200990562 GGGTGGAATGGAAGAGAAGGGGG + Intronic
919778198 1:201207471-201207493 GGGCCCAGTGGAGGACAAGAGGG + Exonic
920123679 1:203676821-203676843 GAGGGGAGGGGAGGACAAGGGGG + Intronic
920690196 1:208140469-208140491 GTGTGTAGCAGAGGACCAGGCGG - Intronic
921277264 1:213532563-213532585 GGGTGCAGTGGAGAACGGGGAGG - Intergenic
921307539 1:213812175-213812197 GGGAGAAGTGAAGGAAAAGGAGG + Intergenic
922440087 1:225647992-225648014 AGGAATAGTGGGGGACAAGGGGG + Intronic
922958365 1:229624855-229624877 GGATGTAGGGGAGGACACGGAGG - Intronic
923146474 1:231202160-231202182 GGAGGTAGTGGAGGAGGAGGTGG + Intronic
923146496 1:231202240-231202262 GGGGGTAGTGGAGAAGGAGGAGG + Intronic
923284724 1:232482582-232482604 GTGTGTAGTGGACAACTAGGGGG + Intronic
924384807 1:243490822-243490844 GGGTCTGGTGGAGGATGAGGGGG - Intronic
1064235028 10:13565718-13565740 GCGTGCAGTGGAGGTGAAGGTGG + Intergenic
1064782110 10:18853395-18853417 GGGTGTGGTGGAGGACTTGAAGG + Intergenic
1064949909 10:20836759-20836781 GGGTGTAAAGGAAGAAAAGGGGG - Intronic
1065092093 10:22245450-22245472 GGCTGTAGTGTAGGACTGGGGGG - Intergenic
1065814686 10:29473120-29473142 GGGTGGAGGGGAGGAGCAGGGGG + Intronic
1065897969 10:30181389-30181411 GGGTGTGGTGGCGGGCACGGTGG + Intergenic
1068041727 10:51833853-51833875 GGCTGGAGTGGAGGAAAAGAAGG - Intronic
1068395734 10:56458768-56458790 GGTTGTAGAGGAGGAAGAGGAGG + Intergenic
1068403587 10:56562153-56562175 GAGAGTAGTGGATGACATGGGGG - Intergenic
1069906760 10:71736518-71736540 GGGGGTAGGGGAGGGCAATGTGG + Intronic
1070781804 10:79141953-79141975 AGGGGTAGTGGAGGAAGAGGTGG + Intronic
1071131978 10:82405098-82405120 GTGTGTGGTTGAGGACAATGAGG + Intronic
1073164544 10:101433474-101433496 GGGAGGAATGGAGGAGAAGGAGG + Intronic
1073512225 10:104049911-104049933 GCCTGGAGTGGAGGATAAGGAGG - Intronic
1074732158 10:116390729-116390751 GGAGGAAGTGGAGGAGAAGGAGG + Intergenic
1074945115 10:118274139-118274161 GGGTGTAATATAGAACAAGGTGG + Intergenic
1076000263 10:126907389-126907411 GGGTGTAGTGGGGGCCATCGGGG + Intronic
1076794848 10:132793495-132793517 GGGTATTGTGGGGGCCAAGGCGG - Intergenic
1077048276 11:555592-555614 GGGCGTACTGGAGGACCAGGGGG + Intronic
1077174237 11:1181430-1181452 GGGTGTGGAGAAGGAGAAGGTGG - Intronic
1078579504 11:12527516-12527538 GGCTGCAGTGGAAGACCAGGGGG - Intronic
1079870988 11:25797645-25797667 GATTGTAGTTGAGGACAAGGGGG - Intergenic
1079936837 11:26627303-26627325 GGGGGAAGAGGAGGAGAAGGAGG - Intronic
1081774246 11:45666439-45666461 GAGTGGAGTGGAGGAGAAGCAGG + Intergenic
1081794394 11:45809624-45809646 GGCTGGAGTGGAGGACAGGGAGG + Intronic
1082833227 11:57634837-57634859 GGGGGTTTTGGAGGATAAGGAGG - Intergenic
1082862854 11:57872185-57872207 GGGAGCAGTGGAGGATTAGGAGG - Intergenic
1085356216 11:75839980-75840002 GGGAGGAAAGGAGGACAAGGAGG - Intronic
1085525635 11:77161938-77161960 AGGTGCAGAGGAGGACACGGAGG - Intronic
1086124871 11:83340154-83340176 GGGTCTAGTTGAGGAGGAGGGGG - Intergenic
1087024878 11:93640121-93640143 GGGAGTATTGGAGGATCAGGAGG - Intergenic
1087960731 11:104345610-104345632 GCATGTGGTGGAGGGCAAGGTGG + Intergenic
1088463915 11:110112727-110112749 GGGTGTTGTAGAGGCCAAGAAGG + Intronic
1088898165 11:114093410-114093432 GAGTGTAGTGGAGGAAGAGAGGG - Intronic
1089348309 11:117806066-117806088 GGATGGAGTGGTGAACAAGGTGG - Intronic
1090253811 11:125268964-125268986 GGGTGGGGTGGAGGGCAGGGGGG + Intronic
1090900394 11:131025912-131025934 GGGTGTTGGGGAGGGCAGGGTGG - Intergenic
1091206590 11:133825404-133825426 GGGTGAAGAGGAGGAGAAAGAGG - Intergenic
1092278989 12:7085596-7085618 GGGTGTGGTGGAGGCAATGGTGG + Intronic
1096231606 12:49900008-49900030 GGGAGAAGTGAAGGACAAGAGGG - Intronic
1096692289 12:53328657-53328679 GGGGGTAGTGGTGGATATGGGGG - Exonic
1096835826 12:54350666-54350688 GGGTGTAGGGGAGGTTGAGGGGG - Exonic
1098440596 12:70513194-70513216 GGCTTTAGTGGAGGACTATGAGG - Intergenic
1098892451 12:76023314-76023336 GGGTGTGTTCTAGGACAAGGTGG + Intergenic
1102011953 12:109624303-109624325 GGGTGTTGGGGAGGCCGAGGGGG + Intergenic
1102505316 12:113380975-113380997 GGGTGCAGTGGAGGATGAGGTGG + Intronic
1102640281 12:114361023-114361045 GGGATAAGTGGAGGACATGGTGG - Intronic
1102697742 12:114813465-114813487 GGGGATGGTGGAGGAGAAGGGGG + Intergenic
1103308981 12:119989603-119989625 GGGGGTAGTGGCGGAGTAGGTGG - Intergenic
1103452993 12:121042660-121042682 GGGTGGAGTGGAGGTGAAAGTGG + Intergenic
1103751270 12:123164759-123164781 TTGTGTTGTGGAGGACAAGGCGG + Intronic
1104143706 12:126011964-126011986 GGAGGAAGAGGAGGACAAGGAGG + Intergenic
1105414319 13:20195147-20195169 CAGTGTAGGGGAGGAGAAGGAGG + Intergenic
1105923803 13:24988374-24988396 GAGTGCTGAGGAGGACAAGGGGG - Intergenic
1106675464 13:31953259-31953281 GCGTGTGGTGGAGGACAAGGTGG + Intergenic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1108333421 13:49413597-49413619 AGGTGGAGTGGTGGACAGGGAGG + Intronic
1108591587 13:51917319-51917341 GGGGGTAGCTGGGGACAAGGAGG + Intergenic
1110910712 13:80959304-80959326 GGGAGTAGAGAAGGAAAAGGTGG - Intergenic
1112068872 13:95825662-95825684 GTCTGCAGTGGTGGACAAGGTGG + Intronic
1113384606 13:109837105-109837127 GGCTGGAGTGGAGGAGCAGGTGG - Intergenic
1113701235 13:112390142-112390164 GGGAGGAGTGGAGGCCCAGGGGG + Intronic
1113965864 13:114153498-114153520 GGATGTAGTGGTGGAGATGGTGG - Intergenic
1114318052 14:21525228-21525250 GGGGGTGGTGGAGGAGGAGGGGG + Exonic
1114318281 14:21526134-21526156 GGGGGAAGTGGAGGGCCAGGTGG + Intronic
1114387149 14:22267333-22267355 GGGTGAAGAGGAAGAAAAGGGGG + Intergenic
1117069337 14:52042533-52042555 AAGTGTAGTGGAGTAGAAGGAGG - Intronic
1118132615 14:62983952-62983974 AAGGGTAGAGGAGGACAAGGAGG + Intronic
1118493694 14:66287025-66287047 GGGAGTAGTGGGAGACGAGGAGG - Intergenic
1118723559 14:68610501-68610523 GGTTGTACGGGAGGACAGGGAGG - Intronic
1120217607 14:81696896-81696918 GTGTGTGGTGGAGGAGAGGGGGG + Intergenic
1120418072 14:84244658-84244680 GGGTCAAGGGGAGGACCAGGTGG - Intergenic
1120588665 14:86348266-86348288 GGGTGTATTTGAGGAAAATGTGG - Intergenic
1121171004 14:91854485-91854507 AGGTGGAGAGGAGGAGAAGGAGG + Intronic
1121245817 14:92460140-92460162 GTGTGTTGTGAAGGACAAGCTGG + Intronic
1121459825 14:94066144-94066166 GGCTGTTGGGGAGGACACGGTGG + Intronic
1122093985 14:99357837-99357859 GGGGGGGGTGGGGGACAAGGCGG + Intergenic
1122321849 14:100860141-100860163 GGGCAGAGTGGAGGGCAAGGGGG + Intergenic
1122552263 14:102556427-102556449 GGGTGCAGTGGGGCCCAAGGAGG + Intergenic
1124558682 15:30750566-30750588 TGGTGGTGTGGGGGACAAGGAGG - Intronic
1125599919 15:40909889-40909911 AGGTCAAGGGGAGGACAAGGGGG - Intergenic
1126876494 15:53047431-53047453 TGGTGGAGGGGAGGAAAAGGGGG - Intergenic
1126950273 15:53873104-53873126 GTGTGTTGAGGAGGAGAAGGGGG + Intergenic
1127275377 15:57438886-57438908 GGGAGTTGTGGATGACGAGGAGG - Exonic
1127279403 15:57476052-57476074 GGGTGCAGAGATGGACAAGGTGG + Intronic
1127661180 15:61101744-61101766 GTGTGTGGTGGAGGAAAAGGAGG + Intronic
1127828449 15:62727236-62727258 GGGTGTAGTGGGGGAGGAGGAGG + Intronic
1129333847 15:74840987-74841009 GGGTGTGGTGGGGGAGTAGGAGG - Intronic
1129975178 15:79815824-79815846 GAGTCTCATGGAGGACAAGGGGG + Intergenic
1130226034 15:82058962-82058984 AGGAGGAGTGGGGGACAAGGAGG - Intergenic
1131018243 15:89075511-89075533 GTGTGAAGGGGAGGAGAAGGAGG + Intergenic
1131116594 15:89799856-89799878 GAGTGTGGAGGAGGGCAAGGAGG - Intronic
1135060695 16:19269036-19269058 AAGTGTTGTGGAGGTCAAGGGGG + Intergenic
1135176700 16:20236242-20236264 GTGTGTGGTGGAGGACATGAAGG - Intergenic
1135204482 16:20471448-20471470 AGGTGTAGGGGAGGAAAGGGAGG - Intronic
1135214404 16:20552363-20552385 AGGTGTAGGGGAGGAAAGGGAGG + Intronic
1135250828 16:20900166-20900188 GGGGGGAGTTGAGGAAAAGGCGG - Intronic
1136180680 16:28549736-28549758 GGGTATGGTGGGGGACAGGGAGG - Intergenic
1138244630 16:55458314-55458336 GGTTGTATTGGAGGACGAGATGG + Intronic
1140280100 16:73546197-73546219 GGTTGTAGTGGGGGAAAGGGAGG - Intergenic
1140655200 16:77132492-77132514 GGGTTTTGAGGAGGACGAGGAGG - Intergenic
1141891754 16:86930862-86930884 GGATGAAGAGGAGGAGAAGGAGG - Intergenic
1143011820 17:3870176-3870198 GGGTGTAGAAAAGGACGAGGTGG - Intronic
1143145324 17:4771696-4771718 GGATGTGGTGCTGGACAAGGTGG - Intergenic
1143247983 17:5501753-5501775 GGGCTTGGTGGATGACAAGGAGG - Intronic
1144018918 17:11222774-11222796 GGGTGGAGACGTGGACAAGGAGG - Intergenic
1145004649 17:19330480-19330502 GGGGTTAGAGGAGGTCAAGGGGG - Intronic
1145180117 17:20742042-20742064 GTTTGTAGTCGAGGAAAAGGTGG - Intergenic
1145296865 17:21599280-21599302 GGGGGAAGGGGAGGACCAGGTGG + Intergenic
1145394868 17:22487129-22487151 GGATGTGGTGAAAGACAAGGTGG + Intergenic
1145752220 17:27363253-27363275 GGGTGGAGTGGAGGCCAGGGAGG + Intergenic
1145895005 17:28451204-28451226 TGGTGAAGTGGAGGAGAAGAGGG - Intergenic
1145941754 17:28746383-28746405 GGGTTTGGTGCAGGAGAAGGCGG + Intronic
1146514828 17:33480871-33480893 GGTTGCAGTGGAAGAGAAGGAGG - Intronic
1146621378 17:34401240-34401262 GGGCGGAGTGGGGGACAGGGAGG - Intergenic
1146830425 17:36064363-36064385 TGGTGCAGACGAGGACAAGGAGG - Exonic
1147425718 17:40345081-40345103 CGGTGCATTAGAGGACAAGGGGG + Intronic
1147459468 17:40559137-40559159 GGGAGTGGAGGAGGACAAGAAGG - Intronic
1147540586 17:41354448-41354470 GGGTGAAGGAGAAGACAAGGAGG + Intergenic
1149681761 17:58512548-58512570 GGCTGTAGAAGAGGATAAGGTGG - Intronic
1149839831 17:59951749-59951771 GTTTGTAGTCGAGGAAAAGGTGG - Intronic
1151992367 17:77584232-77584254 GGGGGTAGTAGAGGACAGGGAGG + Intergenic
1152269353 17:79314840-79314862 GGGTGTAGGGGAGGGGAACGGGG + Intronic
1153642143 18:7166315-7166337 GGGCGTGGAGGAGCACAAGGAGG - Intergenic
1157559634 18:48637331-48637353 GGGTTTGGTGGAGGGCCAGGGGG - Intronic
1157674871 18:49561573-49561595 GGGAGAAGAGGAGGACAAAGGGG + Intronic
1159051128 18:63422242-63422264 GGGCGAAGTGGATGACATGGCGG + Exonic
1160063419 18:75552060-75552082 GGGGGTGGTGGAGGAGAAGGGGG + Intergenic
1160600448 18:80008637-80008659 GGGTGGGGTGGAGGAGAACGGGG - Intronic
1164234780 19:23322810-23322832 GGGAGAAGTGGAGGAGGAGGTGG - Intronic
1164234788 19:23322833-23322855 GGGAGAAGTGGAGGAGGAGGTGG - Intronic
1164234796 19:23322856-23322878 GGGAGAAGTGGAGGAGGAGGTGG - Intronic
1164234804 19:23322879-23322901 GGGAGAAGTGGAGGAGGAGGTGG - Intronic
1164643731 19:29843897-29843919 GGGGAAAGTGGAGGCCAAGGCGG - Intergenic
1165060459 19:33202659-33202681 GTGTGTACGGGAGGCCAAGGAGG - Intronic
1165465669 19:35973492-35973514 GGGAGGGGTGGAGGATAAGGAGG - Intergenic
1165553124 19:36605359-36605381 GGGTGCTGAGGAGGCCAAGGAGG + Intronic
1165811638 19:38615224-38615246 GGGTGGAGTGGAGGGGGAGGAGG + Intronic
1166170664 19:41025775-41025797 CGGTGTATTGGGGGAGAAGGGGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166549756 19:43657397-43657419 GGGTGTAGTGGAGGGAGACGAGG - Intronic
1166733370 19:45070856-45070878 GGGGGGTGGGGAGGACAAGGGGG + Exonic
1166887296 19:45969883-45969905 GGGAGAAGTGGAGGAGATGGTGG - Intronic
1166887824 19:45972736-45972758 GGGTGAAATGGAGGAAATGGTGG - Intronic
1168058475 19:53877024-53877046 GGGTGGGATGGAGGAGAAGGAGG - Intergenic
1168318324 19:55493920-55493942 GGTTGTGGTGGAGGACCGGGAGG + Intronic
1168510162 19:56967379-56967401 GGATGAAGGGGAGGAGAAGGAGG - Intergenic
1168575614 19:57506126-57506148 GGATGTGGTGTAGCACAAGGAGG - Intronic
925285273 2:2711732-2711754 GTGTGTGGTGGGGGACAGGGTGG + Intergenic
925420228 2:3704550-3704572 GGGTGTGGAGGAGGGCATGGGGG + Intronic
925974487 2:9132155-9132177 TGGTGTAGTGGAGGCCAAGGAGG + Intergenic
926006572 2:9377646-9377668 GTGTGTACTGGAGGAGGAGGAGG + Intronic
926486481 2:13466497-13466519 GAGAGTGGTGGGGGACAAGGAGG + Intergenic
926807702 2:16726532-16726554 AGGTGAAGAGGAGGAAAAGGAGG - Intergenic
931205348 2:60140853-60140875 GGGAGAAGAGGAGGAGAAGGAGG - Intergenic
931235116 2:60406435-60406457 GGGTGTGGGGGAGGAAGAGGCGG - Intergenic
932788643 2:74632515-74632537 GGGTTGAGGGGAGGGCAAGGAGG - Intronic
933249704 2:80015522-80015544 GGGTGAAGTAGAGGAGAAGATGG + Intronic
935117097 2:100146143-100146165 GGGATAAGTGGAGGACAACGTGG - Intergenic
935274804 2:101466902-101466924 TGGAGGAGAGGAGGACAAGGAGG + Intronic
935674605 2:105583731-105583753 AGGTTAAGTGGAGGAGAAGGAGG + Intergenic
936740016 2:115493837-115493859 GGCTGTTATGGAGAACAAGGTGG + Intronic
937379985 2:121367764-121367786 GGGGGTAGTGAAGTAGAAGGAGG - Exonic
937943429 2:127309034-127309056 GGGTGAAGAGGAGGAGAAAGGGG + Intronic
939509578 2:143089630-143089652 GGGTGCGGTGGAGCACAGGGTGG + Intergenic
939900415 2:147844289-147844311 GGGCGGAGTGGAGGGCGAGGAGG - Intergenic
939914451 2:148021595-148021617 GGGGGGAGTGGAGGAGGAGGAGG - Intronic
940624031 2:156150138-156150160 GGGTGTAAAGGAAGAAAAGGGGG + Intergenic
941666278 2:168246919-168246941 CGGTGGAGCGGAGGACCAGGCGG - Intronic
944822105 2:203441268-203441290 GGGGGTGGTGGAGGAGGAGGTGG + Exonic
945851312 2:215011236-215011258 TGGGGAAGTGGAGTACAAGGAGG - Intronic
947335650 2:229080058-229080080 GGGTGGACTGGAGAACAGGGAGG - Intronic
947511048 2:230754510-230754532 GGGGGAAGAGGAGGAGAAGGAGG - Intronic
947675358 2:231974161-231974183 TGGTGAAGTGGGGGACAAGGGGG + Intronic
947793587 2:232880919-232880941 GGCTCTAGGGGAGGACAGGGAGG + Intronic
947817453 2:233047787-233047809 GGGTGTCCTGGAGGAGGAGGCGG + Intergenic
947914437 2:233822425-233822447 GGGTGTAGATGAGGTCAGGGAGG - Exonic
1168876896 20:1177957-1177979 GGGAGGAGGGGAGGAGAAGGGGG + Intronic
1169207380 20:3748101-3748123 GGGTGTGATGGAGGAGGAGGTGG + Intronic
1169927397 20:10796980-10797002 GGGTGTAGGGGAGGAAAGGATGG - Intergenic
1169950141 20:11034615-11034637 GGAGGTAGTGGTGGTCAAGGAGG + Intergenic
1170019658 20:11822486-11822508 GGGTGTAGTGCAGGAAAACGGGG - Intergenic
1170312601 20:15008913-15008935 GGGTTTAGTGGAGGAGGAGTTGG + Intronic
1170662646 20:18358165-18358187 GGGTATAGGAGAGGAAAAGGAGG + Intergenic
1172412979 20:34740393-34740415 TGGCCTAGTGGAGGAGAAGGTGG - Exonic
1172649789 20:36494740-36494762 GGGTGAAGGGGAGGGCAAGGAGG - Intronic
1172897223 20:38308813-38308835 GGATGGAGTGAAGGACCAGGTGG + Intronic
1175980873 20:62738004-62738026 GGCTGTTGCGGAGGACCAGGGGG - Intronic
1176072410 20:63234136-63234158 GGGGGCGGTGGAGGACAGGGAGG + Intergenic
1176235466 20:64051633-64051655 GGGTGTTGTGGGGGACGTGGAGG - Intronic
1177836607 21:26192152-26192174 GGGTGTAGTGGAGGCTGATGTGG - Intergenic
1178838128 21:36115498-36115520 GGGTGCAGTGGAGGCTGAGGTGG - Intergenic
1179259925 21:39749136-39749158 CGTTGTAGGGGAGGAGAAGGGGG + Intronic
1180075262 21:45458696-45458718 GCTTGCAGTGGAGGACAAGGTGG - Intronic
1180093820 21:45545376-45545398 GGGAGGAGGGGAGGGCAAGGGGG - Intergenic
1182612575 22:31561289-31561311 GGGTGTGGTGGAGCACGTGGAGG + Exonic
1183021743 22:35033031-35033053 GTGTGTAGTGGGCGACGAGGGGG - Intergenic
1183261253 22:36797332-36797354 GGGGGTTGGGGAGGACAGGGAGG + Intergenic
1183485803 22:38087153-38087175 GGGTGTCATGGGGGACATGGAGG + Exonic
1184019392 22:41810309-41810331 GGGTGGTGCGGAGGACAGGGCGG - Intronic
1184260032 22:43309694-43309716 GGGTGTGGGGGTGGACACGGAGG - Intronic
949909645 3:8891300-8891322 GTGTGTTGTGGAGCACAGGGGGG - Intronic
950539140 3:13599622-13599644 GGGGGTGGTGGAGGAGGAGGTGG + Intronic
950709839 3:14806201-14806223 GGGGGTAGTGGAGGGCAGTGCGG - Intergenic
951695663 3:25443398-25443420 GGGTGGTGGGGGGGACAAGGGGG - Intronic
952017548 3:28976209-28976231 GGGTGGGGAGGAGGAGAAGGAGG - Intergenic
954547638 3:51452187-51452209 GGGTGTAGTGGTGCACACTGTGG - Intronic
954716186 3:52528076-52528098 GGGGGCAGTGGAGGACAATGAGG + Intronic
954967448 3:54624002-54624024 GGGTGTGGAGGAGGAGAAGAGGG + Intronic
955831087 3:63004893-63004915 TGGTGTAGTTGAGGAGAAGCAGG - Intergenic
956057713 3:65318199-65318221 GGGTTGAGTGGTGGAAAAGGAGG - Intergenic
956307787 3:67845498-67845520 GGAAGTGGTGGAGGAGAAGGTGG - Intergenic
957098467 3:75800245-75800267 GGGTGTGGTGCAGGGCACGGTGG - Intergenic
960134737 3:114093900-114093922 TGGAGTTGAGGAGGACAAGGAGG - Intergenic
960583188 3:119297613-119297635 AGTTGGAGTGGAGGACAAAGCGG + Intronic
961345380 3:126260440-126260462 GGAGGGAGAGGAGGACAAGGAGG - Intergenic
961345396 3:126260499-126260521 GGAGGGAGAGGAGGACAAGGAGG - Intergenic
961428759 3:126865171-126865193 GGTGGTAGTGGAGGAGGAGGAGG - Intronic
961486216 3:127218605-127218627 GGGTGGAGCGGAGGAGAGGGAGG - Intergenic
962166168 3:133050672-133050694 GGGTTTAGTGAAGGGCAAAGGGG - Intronic
962530582 3:136276696-136276718 CTGTGTAGTGGTGGACAAGGTGG + Intronic
962812717 3:138973086-138973108 GGGTGTTGTGGAGGGCACAGGGG + Intergenic
963328156 3:143884727-143884749 GGGGGAAGGGGAGGAAAAGGAGG + Intergenic
964892234 3:161551220-161551242 GGGTGCAGTGGGAGACAAGAGGG - Intergenic
965704722 3:171494774-171494796 GGTTGGAGTGGAGGAGAAGCAGG + Intergenic
965768048 3:172152490-172152512 GGGAGTAGTTGAGGACATGAAGG - Intronic
966298853 3:178456028-178456050 GGGTGAAGAGGAAGAAAAGGGGG + Intronic
969571851 4:8013672-8013694 GTGTGACGTGGAGGACAAAGTGG - Intronic
969707541 4:8820111-8820133 GGGTGGAGTGGAGGAGGTGGGGG + Intergenic
970305175 4:14724272-14724294 GAGTGTTGTGGAAGACAATGTGG + Intergenic
971091672 4:23352665-23352687 TGGTGTAGGGCAGGACAAGTAGG + Intergenic
971351751 4:25862375-25862397 GGGTGGAGTCGAGGACAAGAAGG + Intronic
971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG + Intronic
972543479 4:40058442-40058464 GGCTGTAGTGGTGGACATGGTGG + Intronic
972706884 4:41553526-41553548 GGGTGTGGTGGGGGATGAGGAGG + Intronic
975812155 4:78180969-78180991 GGCGGCAGGGGAGGACAAGGTGG - Intronic
976913740 4:90343367-90343389 GGGCATGGTGGAGGCCAAGGTGG + Intronic
977216491 4:94291048-94291070 GGGTATAGTGATGTACAAGGAGG - Exonic
978635963 4:110807554-110807576 GAGTGATGTGAAGGACAAGGTGG + Intergenic
985647861 5:1093562-1093584 GGGCGTGGTGGAGCACGAGGAGG - Exonic
987104808 5:14627773-14627795 GGGTGTGGTGGAGTACAAATGGG + Intergenic
991011358 5:61886172-61886194 GGGAGCAGTGGGGGGCAAGGGGG + Intergenic
991232318 5:64349578-64349600 TGGTGTGGTGGGGGGCAAGGGGG - Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993019681 5:82576774-82576796 GGGTTTAGAGGAGGTCATGGAGG - Intergenic
993905850 5:93621657-93621679 GGGTGGTGTGGAGGGGAAGGGGG + Intronic
996165731 5:120220690-120220712 GGAGGAAGTGGAGGAGAAGGAGG - Intergenic
996954822 5:129170234-129170256 GGGTGGAGTGGAGGGGATGGGGG - Intergenic
996971416 5:129373413-129373435 GGGAGTAGTGGAGAATAAGACGG - Intergenic
997596048 5:135108071-135108093 GAGTGGAGTGGAGGACATGGTGG - Intronic
997745829 5:136299373-136299395 GTGTGTGGTGGAGGAGGAGGAGG + Intronic
997874230 5:137534267-137534289 GGCTGGAGTGGAGGAGCAGGAGG - Intronic
997886761 5:137637285-137637307 GGGCGTTGTGGAGGGTAAGGAGG - Exonic
997952417 5:138252929-138252951 GGGTGTGGTGGAGGGGAAGAGGG + Exonic
998888975 5:146726175-146726197 GGATGCAGTGGTGGAGAAGGAGG - Intronic
999101205 5:149027577-149027599 TTGTGTTCTGGAGGACAAGGTGG + Exonic
999284105 5:150383803-150383825 GGGTGCAGTGGAGCACATGAAGG - Intronic
999375833 5:151085913-151085935 GGGTGTGGGAGAGGACAGGGAGG - Intronic
1000004362 5:157169433-157169455 GTGTGTAGGGGAGGGGAAGGTGG + Intronic
1002643251 5:180640523-180640545 GGGTGTGGTGGAGGCCACTGGGG - Intronic
1003236845 6:4302530-4302552 GGGTGCAGTGGGGGACACAGTGG - Intergenic
1003619200 6:7682840-7682862 GAGTGAAGTGGAGGTGAAGGTGG + Intergenic
1004154838 6:13158382-13158404 GGCTATATGGGAGGACAAGGGGG - Intronic
1004158358 6:13191102-13191124 GGTTGGAGAGGAGGACATGGAGG - Intronic
1004786147 6:18969606-18969628 GGGTGTGGAGGATGGCAAGGAGG + Intergenic
1005181790 6:23114837-23114859 GGGTGGAGAGGAAGACAATGGGG + Intergenic
1005486385 6:26304360-26304382 TGGTTTAGTGGTGGACAAAGGGG - Intergenic
1005943325 6:30577719-30577741 GGGTGGAGTGGAGGGCCAGTGGG + Intronic
1006304071 6:33208470-33208492 GGGTGTAGCGGAGGAGCAGGCGG + Intergenic
1006799976 6:36753480-36753502 GTGGGGTGTGGAGGACAAGGGGG + Intronic
1008737900 6:54569428-54569450 GGGTGGAGTGGAGTGGAAGGTGG - Intergenic
1008776728 6:55048760-55048782 GGATTTAGTGGAGGGCATGGAGG - Intergenic
1008882539 6:56395334-56395356 GTCTGTAGTGGTGGATAAGGGGG - Intergenic
1010097914 6:72068497-72068519 GGGAGAAGTGGAGGAGTAGGGGG + Intronic
1012031806 6:94079289-94079311 GGGTGTAGTGTAAGACAGGAAGG - Intergenic
1012320573 6:97839897-97839919 GAGAGTAGTGGAGGGGAAGGAGG - Intergenic
1012610342 6:101210915-101210937 GGGTGGAGCAGAGGACAAGGAGG - Intergenic
1017246901 6:152236849-152236871 GGGTCTGGTGGAGGAGAACGAGG - Exonic
1017770225 6:157638876-157638898 GGTTCTAGTGGGGGACATGGAGG + Intronic
1018292234 6:162303862-162303884 GGAGGTAGTGGAGGGCCAGGAGG + Intronic
1019563059 7:1667392-1667414 GGGGGTTGTGGAGGGCAGGGGGG + Intergenic
1019892003 7:3954495-3954517 GGGTGTAGAGGAGAAGCAGGAGG - Intronic
1023264321 7:38390540-38390562 GGGTGGAGTTGAGGGAAAGGTGG - Intronic
1023420849 7:39977995-39978017 GGGTGTATTTAAGGAGAAGGAGG + Intronic
1025212823 7:57030698-57030720 GGGTGTTGAGGAGGACGAGAGGG - Intergenic
1025603822 7:63024522-63024544 GGTTATAGTGGAGGAAAAGCTGG - Intergenic
1025659130 7:63546126-63546148 GGGTGTTGAGGAGGACGAGAGGG + Intergenic
1026846720 7:73702810-73702832 GGCTGGAGTGGAGGGCAGGGGGG + Intronic
1027266080 7:76495989-76496011 GGGTGGAGAGAAGGACAAGCGGG - Intronic
1027317458 7:76994106-76994128 GGGTGGAGAGAAGGACAAGCGGG - Intergenic
1029437281 7:100570327-100570349 GGGTGTAGAGGACGATCAGGTGG - Intergenic
1029494621 7:100890180-100890202 GGGCGGAGCGGAGGACATGGGGG + Exonic
1030685699 7:112485023-112485045 GGGTGTGGTGGAGGGGGAGGGGG + Intronic
1030837801 7:114310703-114310725 AGGTGGAGTGGGGGACAAAGGGG + Intronic
1032247676 7:130226726-130226748 GGTTTGAGTGGAGGAAAAGGAGG + Intergenic
1032432705 7:131874834-131874856 GGGTTTAGTGGAAGACAAACTGG - Intergenic
1033283499 7:140022061-140022083 GGGTTTTTTGGAGGACCAGGCGG - Intergenic
1036295192 8:7529181-7529203 GGGAGGAGTGGAGGAGGAGGAGG - Intergenic
1036327378 8:7791837-7791859 GGGAGGAGTGGAGGAGGAGGAGG + Intergenic
1037568843 8:20141576-20141598 AGGAGGAGAGGAGGACAAGGGGG + Intergenic
1037693741 8:21206110-21206132 GGGTGAAGTGAAGGTCATGGGGG - Intergenic
1038227560 8:25670867-25670889 GGGAGTAATGTAGGAAAAGGAGG - Intergenic
1038325481 8:26569569-26569591 AGGTGGAGTGGAGGACTAGGTGG + Intronic
1038862641 8:31403961-31403983 AGGTGTAGGGGAGGATGAGGAGG + Intergenic
1039565209 8:38546785-38546807 ATGTGTAGTGGTGGAGAAGGGGG - Intergenic
1041696653 8:60742966-60742988 GGCTGCAGTGGAGGACAGGTTGG - Exonic
1042885956 8:73552055-73552077 GGTTGTACTGGAGAACAAGGGGG + Exonic
1043970963 8:86527728-86527750 GGGTAGAGTGGAGGGAAAGGGGG + Intronic
1044224467 8:89703826-89703848 GTCTGCAGTGGTGGACAAGGAGG + Intergenic
1046046390 8:108970131-108970153 GGGTGTAGGGGAGGCAGAGGGGG - Intergenic
1046350892 8:113010122-113010144 AGGTGTCTTGGAGTACAAGGTGG + Intronic
1047403195 8:124562988-124563010 GGCTGCTGTGGAGGACAAGCAGG + Exonic
1048264116 8:132970666-132970688 GGGAGTGGTGGATGAAAAGGAGG + Intronic
1048996349 8:139795991-139796013 GGGTTTGGTGGAGGAAGAGGAGG + Intronic
1051708050 9:19901274-19901296 GGGTGTAGGGGAGGACTCAGGGG + Intergenic
1051789415 9:20783780-20783802 GGGAGTGGAGGAGAACAAGGAGG - Intronic
1052495118 9:29214453-29214475 GGGAGTTGTGGATGACACGGGGG - Intergenic
1054723814 9:68630153-68630175 GGGTGTTGTGGAGGTTGAGGAGG + Intergenic
1056413836 9:86357684-86357706 GAGTAGATTGGAGGACAAGGTGG - Intergenic
1056719155 9:89058497-89058519 GGATGTAGTGGAGGATGCGGTGG + Intronic
1056719181 9:89058616-89058638 GGACGTGGTGGAGGACATGGTGG + Intronic
1056719330 9:89059278-89059300 AGATGTGGTGGAGGACATGGTGG + Intronic
1056719349 9:89059353-89059375 GGATGTAGTGGAGGATGCGGTGG + Intronic
1056719360 9:89059414-89059436 GGATTTAGTGGTGGACATGGTGG + Intronic
1056719494 9:89059977-89059999 GGATTTAGTGGTGGACATGGTGG + Intronic
1056719559 9:89060252-89060274 GGATGTGGTGGAGGACATGGTGG + Intronic
1056762224 9:89423894-89423916 GGGAGTAGTGGAGGGAGAGGAGG - Intronic
1056771054 9:89478752-89478774 GGGTGGGGTGGAGGATGAGGGGG - Intronic
1056926710 9:90840395-90840417 GGGTGGAGTGGGGGAAAAGCAGG + Intronic
1057859235 9:98626237-98626259 GGGTGGATTGGAGGAAAATGGGG + Intronic
1059485104 9:114620904-114620926 GGAAGTGGTGGGGGACAAGGAGG - Intronic
1060011092 9:120043344-120043366 GGGTGGAGGTGAGGACAAAGGGG + Intergenic
1060101427 9:120843798-120843820 GAGGGTAGTGGAGGACAAGAGGG - Intergenic
1060840003 9:126785605-126785627 GGGTGAAGTGGAGAACCAGGAGG + Intergenic
1061455643 9:130695661-130695683 GGGTGGGGTGGGGGATAAGGAGG - Intronic
1061967600 9:134025123-134025145 AGGAGGAGTGGAGGAGAAGGAGG - Intergenic
1062028371 9:134350872-134350894 GGGTACAGATGAGGACAAGGCGG - Intronic
1062359722 9:136182023-136182045 GGGTCTAGTGCAGGAGAGGGAGG - Intergenic
1185954781 X:4477868-4477890 GGGTGGTGTGGAGGTCAAGATGG - Intergenic
1186264570 X:7818561-7818583 GGGGGAAGAGGAGGAAAAGGAGG + Intergenic
1186318985 X:8403662-8403684 AGCTGTAGTGGAGGCCAAGAAGG - Intergenic
1186410681 X:9342495-9342517 GGGGGAAGGGGAGGAGAAGGAGG - Intergenic
1187281182 X:17859890-17859912 GGCAGGAGAGGAGGACAAGGAGG - Intronic
1187346863 X:18473562-18473584 GGGAAAAGTGGAGGACAGGGAGG - Intronic
1189298680 X:39936816-39936838 GGGTGGGGTGGGGGACAAAGAGG - Intergenic
1189703483 X:43735828-43735850 GTCTGTAGTGGAGGCCACGGTGG - Intronic
1190490609 X:50979233-50979255 GGGTGTAAAGGAAGAAAAGGAGG - Intergenic
1190982701 X:55470586-55470608 AGGAGCAGTGGAGGAAAAGGTGG + Intergenic
1190985998 X:55502597-55502619 AGGAGCAGTGGAGGAAAAGGTGG - Intergenic
1191877866 X:65814055-65814077 AGTTGTGGTGGAGGACAAAGGGG - Intergenic
1192361547 X:70444188-70444210 GGGTGGAGTGGAGGAGATAGGGG + Intergenic
1192483330 X:71503797-71503819 GGTGGTAGTGGAGGAGGAGGAGG - Intronic
1193732771 X:85121581-85121603 GGGAGGTGTGGAGGAGAAGGAGG - Intergenic
1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG + Intergenic
1197283406 X:124565255-124565277 TGGAGTAGGGGAGGAGAAGGAGG - Intronic
1197286953 X:124607006-124607028 AGATGTGGAGGAGGACAAGGAGG + Intronic
1198936213 X:141904299-141904321 GGGTGTAGGGGAGGGGGAGGAGG + Intronic
1200137012 X:153880086-153880108 GGGTGTAGTGGGAGGCCAGGTGG - Intronic
1200712200 Y:6496614-6496636 GGAAGTAGTGGAGGAACAGGAGG - Intergenic
1200952256 Y:8910009-8910031 GGAAGTAGTGGAGGAACAGGAGG + Intergenic
1201021728 Y:9665350-9665372 GGAAGTAGTGGAGGAACAGGAGG + Intergenic
1202095904 Y:21247947-21247969 GGGTGTATTGGAGCATAAGAAGG + Intergenic
1202240797 Y:22766626-22766648 GGAGGTAGTAGAGGACAAGAGGG - Intergenic
1202393783 Y:24400369-24400391 GGAGGTAGTAGAGGACAAGAGGG - Intergenic
1202477002 Y:25269723-25269745 GGAGGTAGTAGAGGACAAGAGGG + Intergenic