ID: 1107073667

View in Genome Browser
Species Human (GRCh38)
Location 13:36298283-36298305
Sequence ATGCAAAACAATAATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107073667 Original CRISPR ATGCAAAACAATAATCTGGA GGG (reversed) Intergenic
900032783 1:383110-383132 ATGCAAAATAATAATCTCCAAGG - Intergenic
900053626 1:613000-613022 ATGCAAAATAATAATCTCCAAGG - Intergenic
901692124 1:10980483-10980505 TTGCAAAACAAAAACCTGGCTGG + Intronic
901760776 1:11469811-11469833 AGACAAAACAATAATATGGCTGG + Intergenic
902528731 1:17076732-17076754 ATGCAAAAAAATTAGCTGGGCGG - Intronic
903480037 1:23646242-23646264 ATGGAAAACACTTATCTGGATGG - Intergenic
903586864 1:24422545-24422567 ATGCAAAACCACAATTTGCAGGG - Intronic
903641630 1:24863970-24863992 ATACAAAACAATTAGCTGGGCGG - Intergenic
904870166 1:33612419-33612441 ATCCAAAACCATGAACTGGAAGG - Intronic
904969346 1:34406759-34406781 AAGCAGAACAATAAACAGGAAGG - Intergenic
905132642 1:35772530-35772552 ATGCATCAGAATAATCTGAAAGG + Intergenic
906513026 1:46422369-46422391 ATGCAAAAAAATTAGCTGGGGGG - Intergenic
907360781 1:53912792-53912814 ATGCAACAAAATCACCTGGAGGG + Intergenic
908507896 1:64824101-64824123 ATGAAAAACAAAAATCAGGCCGG - Intronic
909103048 1:71375055-71375077 ATGGAAACCATTAATTTGGAGGG + Intergenic
909173216 1:72321497-72321519 ATTCAAAAAAATAATTTGAAAGG + Intergenic
909231836 1:73101295-73101317 ATGCAAAAGAAAAATCTTAAAGG + Intergenic
909938350 1:81580994-81581016 ATGAAAAACAATTGTTTGGAAGG - Intronic
909947678 1:81682036-81682058 TTGCCAAACCAAAATCTGGAAGG - Intronic
910376486 1:86577340-86577362 ATGCAAAGGAATCATCTCGAGGG + Intronic
911415986 1:97575036-97575058 ATGCATCACAATCACCTGGAAGG + Intronic
911435209 1:97846954-97846976 ATTCAAAACCATAAAGTGGAGGG + Intronic
911596281 1:99801831-99801853 ATGCAAAAACATATTCTGAAAGG - Intergenic
913324231 1:117612657-117612679 ATGCAAAACAAAAACCTGGATGG + Intronic
915083389 1:153367370-153367392 AAGCAAACTAAAAATCTGGAGGG - Intergenic
916083628 1:161252533-161252555 ATACAAAAAAATTAGCTGGATGG + Intergenic
916417665 1:164607787-164607809 AGGCAAGAGAAAAATCTGGAGGG + Intronic
916781185 1:168031538-168031560 ATTCAAAACAATAAGCTAGGAGG + Intronic
917115385 1:171597995-171598017 ATGCAAAAGATAAATCTTGAAGG + Intergenic
918209298 1:182336866-182336888 ATGCAACAGAATCACCTGGAAGG - Intergenic
918817282 1:189204657-189204679 ATACAAAACAAGAGTCTGCAAGG - Intergenic
919751189 1:201039367-201039389 ATGCAGAAAAATAATCCAGATGG + Intergenic
919994615 1:202737253-202737275 ATGTATAAGAATCATCTGGAAGG + Intronic
920504258 1:206505730-206505752 ATGCATCACAGTCATCTGGAGGG - Intergenic
921542952 1:216440049-216440071 AAGTAAAACAAAAATTTGGAGGG + Intergenic
921551623 1:216543267-216543289 ATACAAAATGATAATCTTGAAGG - Intronic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
923646486 1:235826634-235826656 ATTCTAAACAATGATCTGGGTGG + Intronic
923852355 1:237810928-237810950 ATGCATAACATTTTTCTGGAGGG + Intronic
924257739 1:242199028-242199050 ATACAAAACAATAATGAGGCAGG - Intronic
924681924 1:246244463-246244485 ATGCAAAGCAGCAATCTGAAAGG + Intronic
1063610388 10:7557208-7557230 GTGGAAAACAAGAATCTAGAGGG + Intergenic
1063791999 10:9461074-9461096 ATGCAGAAAAATAATCTCGTAGG - Intergenic
1066211719 10:33246531-33246553 AACCAAAACATTCATCTGGAAGG - Intronic
1066465382 10:35645510-35645532 ATCCAATATAAGAATCTGGATGG + Intergenic
1068343025 10:55733590-55733612 ATGAACAACACTAATATGGATGG - Intergenic
1068763806 10:60740725-60740747 AAGGGAAAAAATAATCTGGAAGG + Intergenic
1069079857 10:64077279-64077301 ATGCAAAACAGGCAGCTGGATGG + Intergenic
1069123881 10:64605285-64605307 ATGCAAAGCAATAATTTGGATGG + Intergenic
1069388226 10:67904075-67904097 ATGAAAAAAATTACTCTGGAAGG - Intronic
1070804388 10:79262347-79262369 ATGCATTAGAATAATCTGGAAGG - Intronic
1070922763 10:80198594-80198616 ATGTATAAGAACAATCTGGAAGG - Intronic
1072096056 10:92181461-92181483 ATGCAATATAATAATCAGAATGG + Intronic
1072182690 10:93002540-93002562 ATGCAACAGAATCAACTGGAGGG - Intronic
1073630628 10:105144987-105145009 ATGCACCAGAATCATCTGGAGGG + Intronic
1074552072 10:114453561-114453583 ATTCAAAACAACAGACTGGAAGG + Intronic
1075485602 10:122819747-122819769 AATCAAAACAAGGATCTGGAAGG - Intergenic
1076039692 10:127234661-127234683 ATGCAAAAGAATAAATTGGCAGG + Intronic
1077622675 11:3741324-3741346 ATTAAAAACAAAAATCTGGCAGG + Intronic
1078081796 11:8209449-8209471 TTGCAAAATAAGAAACTGGAAGG - Intergenic
1079753965 11:24232966-24232988 ATGGAAAACAAAAATGTGCAGGG - Intergenic
1080683658 11:34497885-34497907 ACTCCAAACAATAATCTTGAAGG - Intronic
1081060729 11:38472557-38472579 AAGCAAAACAATAATTTTAAAGG - Intergenic
1081071210 11:38611060-38611082 ATACAAAAAAATAATCTTTAGGG - Intergenic
1083085353 11:60137033-60137055 ATTCAAAATAATAATCTTAAGGG + Intergenic
1084467262 11:69332865-69332887 ATACAAAACAAAAATCATGATGG - Intronic
1086133894 11:83427690-83427712 GAGCAAAACAAGAATCTGGCAGG + Intergenic
1086599344 11:88613504-88613526 ATGGAAAACAAAAAACTGCAGGG - Intronic
1086922793 11:92606315-92606337 TTGCAAACCAACAACCTGGAAGG - Intronic
1087162313 11:94960722-94960744 AAGCAAAGCAATAAAGTGGATGG + Intergenic
1087586186 11:100124920-100124942 ATGCATAAAATTAATCTGGATGG + Intronic
1089947373 11:122490869-122490891 GTGCATAAGAATCATCTGGAGGG + Intergenic
1090489489 11:127145822-127145844 ATGCATGAGAATTATCTGGAGGG + Intergenic
1090935891 11:131342006-131342028 GTGTAAAGCAATAAACTGGATGG + Intergenic
1091591387 12:1844988-1845010 ATGCAAAACCATAATTAGCAAGG - Intronic
1094124369 12:27007508-27007530 ATCCATTACAATCATCTGGAGGG + Intronic
1095349283 12:41189385-41189407 ATGGAAAACGAGAGTCTGGATGG - Intronic
1097098428 12:56568937-56568959 ATGCAAAGTAATAATCTGGGGGG - Intronic
1097416512 12:59322803-59322825 AGGCAAAATGGTAATCTGGAAGG + Intergenic
1097443795 12:59645007-59645029 AGGAAAAACAATAATAGGGAAGG - Intronic
1097633161 12:62088798-62088820 ATGCAAAATAATAATGTGTTTGG - Intronic
1098199320 12:68038043-68038065 CTGCAAAGAAATCATCTGGAAGG - Intergenic
1098732024 12:74048442-74048464 ATGTAAAAGGATATTCTGGAAGG - Intergenic
1098941546 12:76542465-76542487 ATGCATCACAATCATCTGGAGGG + Intronic
1099662074 12:85576848-85576870 ATACAAAAAAATTAGCTGGATGG + Intergenic
1100923411 12:99516063-99516085 ATGCAAACTAATAATCTGACAGG - Intronic
1101135733 12:101741088-101741110 AAGCAAAACAGTAAACAGGAGGG - Intronic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101623014 12:106408507-106408529 ATGCACTAGAATCATCTGGAGGG - Intronic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1102209927 12:111119067-111119089 TTTCCCAACAATAATCTGGAAGG + Intronic
1102411540 12:112724596-112724618 ATGAACAACAATAACCTGGTTGG - Intronic
1102435597 12:112920785-112920807 ATGGAAGAATATAATCTGGACGG - Intronic
1102933146 12:116877627-116877649 ATGCACAATAATAATCATGATGG + Intronic
1103551725 12:121742869-121742891 ATTAAAAACAATAAGCTGGCCGG - Intronic
1103585007 12:121946112-121946134 CTGATAAACAATAATCAGGATGG - Intronic
1104261834 12:127190904-127190926 GTGCAAATCAAGAACCTGGAAGG + Intergenic
1105584411 13:21730724-21730746 TTCCAAAAGAAAAATCTGGAAGG + Intergenic
1106856494 13:33859283-33859305 ATGCAAAACAAGAATTTTGAGGG + Intronic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107279987 13:38722550-38722572 ATGCATCAAAATAACCTGGAGGG + Intronic
1107461629 13:40609221-40609243 ATGCAATAAAGTCATCTGGAGGG + Intronic
1107477661 13:40755043-40755065 ATAAAAAATAATAAACTGGAGGG + Intronic
1107843395 13:44483930-44483952 ATTCATAAAAATAATCTAGAAGG - Intronic
1108843146 13:54646144-54646166 ATGGAAAACAAAAGTTTGGAAGG - Intergenic
1109408488 13:61933479-61933501 ATACCAAACAATATTCTAGATGG + Intergenic
1109564723 13:64097005-64097027 TTGCAAAACAATAATTGGTATGG + Intergenic
1109776111 13:67042944-67042966 ATACAAAACAATAAATTAGAGGG + Intronic
1110068204 13:71136781-71136803 ATGTAAAATGATAATCTGCAAGG + Intergenic
1110873373 13:80479283-80479305 ATGCACCACAATCACCTGGAGGG - Intergenic
1110919048 13:81061712-81061734 ATGCCAAGCAATACTCTTGAGGG - Intergenic
1111133548 13:84007607-84007629 AGGAAAAACAATCTTCTGGAAGG - Intergenic
1111816445 13:93159913-93159935 TTTCAACACAAGAATCTGGAGGG + Intergenic
1112106312 13:96243702-96243724 ATGCAAATTAATAGTTTGGAAGG + Intronic
1112999735 13:105620243-105620265 ATGTAAAACAATAATTTACAAGG + Intergenic
1113446274 13:110370155-110370177 ATGCAATGCAATAATCTGGTTGG - Intronic
1114151452 14:20044555-20044577 ATGTCAAATAATAATCAGGACGG - Intergenic
1114517999 14:23312564-23312586 ATGCAAATTGATAAACTGGATGG + Intronic
1115347768 14:32361533-32361555 ATCCAAAACAAAAAACTAGATGG - Intronic
1116100643 14:40429666-40429688 ATGCAAAAGGAAAATCTTGAAGG + Intergenic
1117453783 14:55877623-55877645 AAGAAAAAGAATAATCTGCAAGG - Intergenic
1117782881 14:59252947-59252969 ATGCAAAAAAAGAAAATGGATGG - Intronic
1118426516 14:65669866-65669888 ATGCATGAGAATCATCTGGAAGG + Intronic
1119800129 14:77436737-77436759 ATGTATAACAATAATGTGGCCGG - Intronic
1120969496 14:90195544-90195566 ATGCAAAACAATAATTAGCCAGG + Intergenic
1121485394 14:94310587-94310609 AGGCAAAAAAACAAGCTGGATGG - Intronic
1121601327 14:95205928-95205950 ATGGAAAACAATAACCAAGATGG + Intronic
1125160692 15:36640087-36640109 ATGCAAAATGGAAATCTGGAGGG - Intronic
1125548465 15:40526190-40526212 ATGAAAAAAAATGTTCTGGAAGG - Intergenic
1125657054 15:41366683-41366705 ATTCAAAATAATAATCTTAAGGG - Intronic
1126180781 15:45783029-45783051 ATAGAAAACCACAATCTGGAAGG + Intergenic
1126553385 15:49958372-49958394 AAGCAAAACAAAAAACTGTAAGG + Intronic
1126898668 15:53287733-53287755 ATGCAACAGAATACCCTGGAAGG - Intergenic
1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG + Intronic
1129626699 15:77208174-77208196 ATTCAATACAATAATCTTGAGGG + Intronic
1130844084 15:87727831-87727853 AAGGAACACAAGAATCTGGAAGG - Intergenic
1131610790 15:93960839-93960861 ATGAAAATCATTAATCTGCAAGG - Intergenic
1131870215 15:96756474-96756496 ATGGAAAAAAATATTCTGTAAGG + Intergenic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1135891229 16:26359268-26359290 AGGCAAAAAAATCTTCTGGAAGG - Intergenic
1137422225 16:48344924-48344946 AAACAAAACAACAATCTGGCTGG + Intronic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138369498 16:56515175-56515197 ATGCAAATCAAGTATCTTGAAGG + Intronic
1138371452 16:56530330-56530352 ATACAAAACAATTAGCTGGGTGG + Intergenic
1138628418 16:58272310-58272332 ATACAAAACAAATATCTGGCCGG - Intronic
1141244172 16:82290975-82290997 ATACAAAAAAATAAGCTGGGAGG - Intergenic
1143745534 17:8991248-8991270 ATTTAAAACATTAATCTGGCCGG - Intergenic
1145891339 17:28418308-28418330 AAACAAAAAAATACTCTGGAGGG - Intergenic
1147467863 17:40625677-40625699 ATCAAAACCAAAAATCTGGAGGG + Exonic
1148572781 17:48683761-48683783 TTGCAAAGCAACAATCTGGAAGG - Intergenic
1148635719 17:49148007-49148029 ATGCAAAATAATCCTCTGGGTGG + Intronic
1149954487 17:61033221-61033243 ATGCATCAGAATCATCTGGAGGG + Intronic
1150638804 17:66935393-66935415 ATGCAAAAATAAATTCTGGAAGG + Intergenic
1152050067 17:77967217-77967239 TTGCAAAGCATTAATCTGCAAGG - Intergenic
1152302207 17:79501663-79501685 ATGCAAATCAATAATGTATAAGG - Intronic
1203193464 17_KI270729v1_random:210461-210483 ATGAAATACAATAGTATGGAGGG + Intergenic
1203202827 17_KI270730v1_random:9891-9913 ATGAAATACAATAGTATGGAGGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153496446 18:5704584-5704606 ATGCACCAGAATGATCTGGAGGG + Intergenic
1153797550 18:8638445-8638467 ATGAAATATAATAATTTGGAGGG - Exonic
1156441674 18:37195741-37195763 GAGCAAAACAAAAAGCTGGAGGG - Intronic
1156633539 18:38998154-38998176 ACACAAAACAAAAATCTTGAAGG - Intergenic
1156647010 18:39176214-39176236 ATGTAAAAAAATAATCTTAATGG - Intergenic
1156909792 18:42397916-42397938 ATGCAGAACAATAAAAGGGAAGG + Intergenic
1158142605 18:54270648-54270670 ATACAATACAATATTCTGGTTGG - Intronic
1158302005 18:56062933-56062955 ATGTAAAACAAAAAACTGTATGG + Intergenic
1158349698 18:56552478-56552500 ATACAAAAAAATCATCTGGGCGG - Intergenic
1162653353 19:12108703-12108725 ATGCATAACAAAAATGTGGTAGG - Intronic
1165711638 19:38015373-38015395 ATGCAGAACAATGACATGGAAGG - Intronic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1167816855 19:51890443-51890465 ATGAAAAACAATATTGTGGGAGG + Exonic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
926865601 2:17354435-17354457 ATGCATCACAAGCATCTGGAAGG + Intergenic
927143007 2:20142430-20142452 ATGCATCAGAATCATCTGGAGGG - Intergenic
928072190 2:28227923-28227945 TTGCTTAAGAATAATCTGGAGGG - Intronic
928150632 2:28825368-28825390 ATGCAATACAATTATCTGTAAGG + Intronic
929267843 2:39939045-39939067 GTGCATAAGAATCATCTGGAGGG + Intergenic
930278025 2:49336476-49336498 ATGGAAAACTATTATCTGCAAGG - Intergenic
930408932 2:50998804-50998826 GTGCAAAACAAGAATTTGAAAGG - Intronic
930782892 2:55241119-55241141 ATGAAAAAAATTAACCTGGACGG + Intronic
931010105 2:57901500-57901522 ATGCAAAAGAATAGTCTCAAAGG + Intergenic
932716959 2:74107944-74107966 AGGCAAACCAATAAAGTGGAAGG - Exonic
932914696 2:75844096-75844118 TTGCCAAAGCATAATCTGGATGG + Intergenic
933077340 2:77945613-77945635 AAGAAAAACAAAAATCTAGAGGG - Intergenic
933334829 2:80944419-80944441 ATGCATCAGAATTATCTGGAGGG - Intergenic
933349672 2:81137380-81137402 ATGATACAAAATAATCTGGATGG + Intergenic
935084427 2:99830814-99830836 ATGCACAACAATAAACAGCATGG - Intronic
935146558 2:100399458-100399480 ATTCAATACAATTATTTGGAAGG - Intronic
936632879 2:114222818-114222840 AAGGAAAATAAAAATCTGGACGG + Intergenic
938400785 2:130989640-130989662 ACAGAAAACAAAAATCTGGAAGG - Intronic
938942536 2:136181563-136181585 ATGCCAAACACTGTTCTGGAAGG + Intergenic
939280851 2:140062929-140062951 CTACAAATCAATAATCTTGAGGG + Intergenic
939486720 2:142822574-142822596 ATACAAAATAGTAATCTGCATGG + Intergenic
939842820 2:147209006-147209028 ATGCATAAAAATCAACTGGAGGG - Intergenic
939997140 2:148930501-148930523 ATGAAAAACACTAAGCTGGAAGG - Intronic
941495780 2:166200419-166200441 ATGTAAAACACTATTATGGAGGG - Intronic
941552092 2:166929180-166929202 ATGCATTAGAATCATCTGGAGGG - Intronic
942968548 2:181927837-181927859 TGTCAAAAAAATAATCTGGAAGG - Intronic
943518564 2:188918342-188918364 ATGAAAAACAAGATTCTGAAAGG + Intergenic
943904745 2:193485141-193485163 ATGCAATACCATACTCTGGCTGG - Intergenic
944791213 2:203129103-203129125 GTGCACGAGAATAATCTGGAGGG - Intronic
945144365 2:206721545-206721567 ATGCAAAACAGTAATCTTTGAGG + Intergenic
945484127 2:210374688-210374710 ATGCAAAACAATATTGTTTAGGG + Intergenic
946167916 2:217876600-217876622 TTGCAAAACAGGAATCTGAATGG - Intronic
946282333 2:218675015-218675037 ATGCAAAATAATACTCAGAATGG - Intronic
946505215 2:220292830-220292852 TTGTAAAAGAATAAACTGGATGG - Intergenic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
1169293467 20:4372432-4372454 ATGCACAAAAATCACCTGGAGGG - Intergenic
1169490196 20:6064885-6064907 AAGCAAAACAATCATCTAGGGGG - Intergenic
1169947872 20:11008811-11008833 ATGCACTACAATATTCAGGATGG - Intergenic
1171026073 20:21631556-21631578 TTTCAAAACAAAAATGTGGAAGG - Intergenic
1171330623 20:24334854-24334876 ATGCAATATAATATCCTGGATGG + Intergenic
1174706974 20:52667178-52667200 ATGCAAAAAAATAATTTTAAAGG - Intergenic
1174934244 20:54850232-54850254 ATGCAAAACAATCATTGGAAGGG + Intergenic
1175082420 20:56432218-56432240 ATCTGAAACAATAATCTGAAAGG - Intronic
1177823054 21:26052819-26052841 GTGCATAAAAATAATCTGAAGGG + Intronic
1178564885 21:33674514-33674536 ATTAAAAATAATAATATGGAGGG + Intronic
1181380015 22:22494687-22494709 ATGCATAGAAATAATCTGGAAGG - Intronic
1183215762 22:36478809-36478831 ATACAAAAAAATTATCTGGGTGG + Intronic
949090038 3:16541-16563 ATGCAAAAGAATAACATAGAAGG + Intergenic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
950130566 3:10542751-10542773 AAACAAAACAAAAATCTTGAAGG - Intronic
950298207 3:11850265-11850287 ATGCAAAACCACCAGCTGGAAGG + Intergenic
950911830 3:16603846-16603868 ATGCATAAAAATAATCTAGAAGG + Intronic
951846580 3:27091008-27091030 ATGCATAATAATTATCTGGGAGG + Intergenic
953501855 3:43444045-43444067 ATGCAAGAAAATAATCTAAAGGG + Intronic
955339051 3:58110744-58110766 ATGCAAAACAATTAGCTGAGTGG - Intronic
955951452 3:64246547-64246569 GTGCAACAGAATCATCTGGAAGG + Intronic
957616119 3:82529610-82529632 ATGAAAAAAAGAAATCTGGAGGG - Intergenic
957661252 3:83156323-83156345 ATGCATTAGAATAACCTGGAAGG - Intergenic
958530899 3:95329379-95329401 ATGGAACAAAATAATCTGGATGG - Intergenic
958642183 3:96818482-96818504 AAGCAAAACAATAGTGTGGCTGG + Intronic
958917507 3:100066013-100066035 GTGCATTAGAATAATCTGGAAGG - Intronic
958947758 3:100382955-100382977 AATCAAAATAATAATATGGAAGG + Intronic
959873492 3:111354918-111354940 ATTCAAAGCAATAATATGAAAGG + Intronic
959945807 3:112124310-112124332 ATAAAAAAGAATAATCTGGCTGG + Intronic
962240896 3:133750032-133750054 TTGCAACACAATCATCAGGATGG - Intronic
963395120 3:144722423-144722445 ATACCAAAGGATAATCTGGATGG + Intergenic
964084557 3:152800218-152800240 ATCCAAAAGAACAATCTGGTAGG + Intergenic
964914417 3:161822625-161822647 ATCCAAAACAATAATGAGTAAGG - Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
967490189 3:190081684-190081706 ATGCAAAACAGTAATATGCAGGG - Intronic
967680138 3:192352334-192352356 GTGCATCAGAATAATCTGGATGG + Intronic
969892671 4:10274276-10274298 ATGCAAAAGAAGAATATGGTGGG + Intergenic
970040560 4:11792742-11792764 ATGCAAAACAAAAATTTGAGGGG + Intergenic
970095660 4:12460522-12460544 CTGGAAAACAATAATCAGGGAGG - Intergenic
970341177 4:15108564-15108586 ATGCAATAAAACTATCTGGAGGG - Intergenic
970476145 4:16425929-16425951 TTGCAAAATAATAAAGTGGAAGG - Intergenic
970829659 4:20321962-20321984 CTGCTAAATAAGAATCTGGAGGG + Intronic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
975309402 4:72885565-72885587 AAGCAAAAAAATAATTTTGAAGG - Intergenic
975599489 4:76084541-76084563 TTTAAAAACAAAAATCTGGAAGG + Intronic
975670694 4:76778027-76778049 CCGCAAAAGAATCATCTGGAAGG + Intronic
975915021 4:79314416-79314438 GTGCAAAACAATCACCTGGAGGG + Intronic
976615909 4:87076628-87076650 ATGCTAAAGATTAATATGGATGG - Intronic
976928883 4:90537826-90537848 ATGCAAATCATAAAACTGGAGGG - Intronic
977589676 4:98812838-98812860 GAGCAAAATAAAAATCTGGACGG + Intergenic
978651723 4:111013808-111013830 ATAAAATATAATAATCTGGATGG + Intergenic
979853583 4:125603958-125603980 ATGCCAAACGATAATCTAAATGG - Intergenic
981227866 4:142318132-142318154 ATGAAATACAACAATCTGTAGGG - Intronic
981363763 4:143877421-143877443 ATGCATAAGAATACTGTGGAAGG - Intronic
981374493 4:143998197-143998219 ATGCATAAGAATACTGTGGAAGG - Intronic
981384819 4:144117509-144117531 ATGCATAAGAATACTATGGAAGG - Intronic
982525491 4:156472656-156472678 GTGCAAAACATGAATCTAGAAGG - Intergenic
982685054 4:158478603-158478625 ATCCAAAACAATATTTTGCAAGG + Intronic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
983242752 4:165252114-165252136 ATGCTAAATCATAATCAGGATGG - Intronic
984152641 4:176153141-176153163 ATGCAAGAGAATAACATGGAGGG - Intronic
986146895 5:5086687-5086709 ATGGAAAACATTAGTTTGGAGGG - Intergenic
986581101 5:9266367-9266389 ATGGAAATAAATGATCTGGAGGG + Intronic
987179374 5:15350689-15350711 ATGCACAAGAATAATTTGCATGG - Intergenic
988961260 5:36373825-36373847 ATGCAAAGTTATAATCAGGAGGG + Intergenic
989848178 5:46172614-46172636 CTGCAAAACAAGAAACTAGAGGG - Intergenic
990514101 5:56516189-56516211 ATGCAGAATAATCATCTGTATGG + Intronic
990714870 5:58625470-58625492 ATGAAAGAGATTAATCTGGATGG - Intronic
992206870 5:74439435-74439457 ATACAATACAAAAATCTTGATGG - Intergenic
992646066 5:78812287-78812309 AAGGAAAACAATACCCTGGAGGG + Intronic
995898617 5:117044017-117044039 GTGCAAAACACAAATCTGTAAGG - Intergenic
996215804 5:120863974-120863996 ATGCCACACACTTATCTGGAGGG + Intergenic
1001719536 5:173845552-173845574 ATGCACCAGAATCATCTGGAGGG - Intergenic
1002288858 5:178185301-178185323 ATCTAAAAGAATAATTTGGATGG - Intergenic
1002741037 5:181435758-181435780 ATGCAAAATAATAATCTCCAAGG + Intergenic
1003243849 6:4367897-4367919 ATGCATCAGAATCATCTGGAAGG + Intergenic
1004322091 6:14639892-14639914 ATGAAAGACAAGATTCTGGATGG + Intergenic
1004343707 6:14829439-14829461 AAACAAAACAAAAATATGGAGGG + Intergenic
1004678422 6:17867310-17867332 AAGAAAAACAAAAATCTGGGAGG + Intronic
1005402829 6:25451999-25452021 ATTCAAAACAGTATTCTGGGGGG - Intronic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1007436132 6:41812373-41812395 GTGCAAAAAAATCATCTGGCCGG - Intronic
1008935231 6:56984771-56984793 ATACAAAACAAAAAGCTTGAAGG + Intronic
1009500019 6:64400637-64400659 ATGCTAAACAATAATGTTGTAGG - Intronic
1009862946 6:69358309-69358331 ATGCATCAAAATTATCTGGATGG - Intronic
1010377644 6:75190912-75190934 ATGATAAACAGTGATCTGGAGGG + Intronic
1010859074 6:80882859-80882881 AAGCAAAACATGAATCTAGAAGG + Intergenic
1011357817 6:86490542-86490564 ATCCAAAACAATAATATGTATGG + Intergenic
1011381017 6:86742263-86742285 ATGCAAAATCATGATCAGGATGG - Intergenic
1011734988 6:90301584-90301606 ATGCATAGGAAAAATCTGGAAGG + Intergenic
1011977603 6:93324465-93324487 ATGAAATACAATAATCTAGCAGG + Intronic
1013140076 6:107324641-107324663 ATGCAAACAAAGAGTCTGGAAGG - Intronic
1013992897 6:116275497-116275519 ATGCAAAACATTATGCTAGATGG + Intronic
1014799539 6:125762645-125762667 TTGAAAAATAATAATCTGGCTGG - Intergenic
1016558927 6:145372436-145372458 AGGCAAAACTATAAACTGAAAGG - Intergenic
1017260953 6:152386545-152386567 ATGCCAAAGAATAATCATGAAGG + Intronic
1017696931 6:157025370-157025392 ATGCATAACAATGATGTGTAAGG + Intronic
1019246142 6:170711353-170711375 ATGCAAAATAATAATCTCCAAGG + Intergenic
1019955074 7:4406953-4406975 AAGGAAAAGAGTAATCTGGAAGG + Intergenic
1020743693 7:12054552-12054574 ATGCATCAGAATTATCTGGAAGG - Intergenic
1020808283 7:12818584-12818606 ATTCATAAGAACAATCTGGAAGG + Intergenic
1021277461 7:18671282-18671304 ATGCATAACAATCCTCTCGAGGG + Intronic
1021446677 7:20741561-20741583 ATAGAAAAAAAAAATCTGGAAGG - Intronic
1021889188 7:25171060-25171082 ATGCACAAGAATCACCTGGAGGG - Intronic
1022160692 7:27708103-27708125 ATGCATGGAAATAATCTGGAAGG + Intergenic
1022208791 7:28188124-28188146 ATGCCAAACAATTAGCTGAAAGG - Intergenic
1023115791 7:36860983-36861005 ACGCAAAACAAAAATTTGAATGG + Intronic
1023877796 7:44298150-44298172 ATACAAAACAATAATCAAAATGG + Intronic
1024394733 7:48853007-48853029 CTGCAACACAGAAATCTGGAAGG - Intergenic
1024802672 7:53099114-53099136 ATGCAAAACAGAAATTAGGAAGG + Intergenic
1024857287 7:53796417-53796439 TTGTCAAACACTAATCTGGATGG + Intergenic
1024868999 7:53939997-53940019 ATACATAACAATAAACTGGCCGG - Intergenic
1027936787 7:84615986-84616008 ATACAAAATAATAATGTAGAAGG - Intergenic
1028038553 7:86018358-86018380 ATGCTAAATAATACTCTGGGTGG - Intergenic
1031282888 7:119826997-119827019 GTACAAAACAATAATCTGGCTGG - Intergenic
1031756157 7:125645468-125645490 ATATATAACAAAAATCTGGAAGG - Intergenic
1032867221 7:135938396-135938418 ATACAAAACAAATATCTGAAAGG + Intronic
1034291817 7:149938603-149938625 ATGGAATTGAATAATCTGGATGG - Intergenic
1035429723 7:158809834-158809856 ATGCAGAACTATAACCTGGCTGG + Intronic
1035501978 8:96845-96867 ATGCAAAATAATAATCTCCAAGG - Intergenic
1035816323 8:2545043-2545065 ATGCAAAGCAAAACTCTGGACGG + Intergenic
1036438546 8:8758960-8758982 ATGCATCAGAATCATCTGGAGGG - Intergenic
1036976008 8:13413522-13413544 ATGCACAAAATAAATCTGGAAGG + Intronic
1037692760 8:21196259-21196281 AAGCAAAGCAATAACTTGGAGGG - Intergenic
1038161294 8:25041366-25041388 ATTCAAAACCATGATCTGGTAGG + Intergenic
1038590710 8:28834830-28834852 ATGCAAAAAAATTAGCTGGGTGG - Intronic
1039280429 8:35978372-35978394 AGGCAAAACAATATTATGCATGG + Intergenic
1039360342 8:36870065-36870087 ATGGAAAAGAATGTTCTGGAGGG - Intronic
1041973347 8:63768454-63768476 AAGTAAAACAAGACTCTGGAAGG - Intergenic
1043854098 8:85245340-85245362 ATACAAAACAATAATGACGATGG - Intronic
1044485824 8:92753109-92753131 ATATAAAACATTAATGTGGAGGG + Intergenic
1044570738 8:93715487-93715509 ATGCATAGGAAAAATCTGGAAGG - Intronic
1045724626 8:105158119-105158141 ATGCAAAACAATCAGCTGAAGGG + Intronic
1046482862 8:114845830-114845852 ATGTGATAAAATAATCTGGAAGG + Intergenic
1048311683 8:133327460-133327482 ATACAAAAAAATTAGCTGGATGG + Intergenic
1048829290 8:138460391-138460413 ATGCAAAACAGCAGCCTGGAGGG + Intronic
1048902495 8:139052182-139052204 ATGCAAAATAAAATTCTTGAAGG + Intergenic
1049910072 9:257465-257487 CTGCAACAGAATCATCTGGAGGG + Intronic
1050135744 9:2461863-2461885 ATCCAAGCCAAGAATCTGGATGG + Intergenic
1051734732 9:20186840-20186862 AAGGAAAATTATAATCTGGAGGG - Intergenic
1052589529 9:30473376-30473398 ATGCAATAAAATAATCTGTTAGG + Intergenic
1052711733 9:32065268-32065290 ATGTCATACAATAATATGGAAGG - Intergenic
1054706954 9:68472354-68472376 ATCCAAAAGAATAACCAGGAGGG - Intronic
1055293400 9:74808742-74808764 ATGTAAAACAAGAATATGGGAGG + Intronic
1056335557 9:85565102-85565124 ATGAAATACAATAGGCTGGATGG - Intronic
1056479737 9:86989303-86989325 ATGCAGACCAAAAACCTGGAAGG + Intergenic
1056775327 9:89508085-89508107 ATGCAAAACCTTAATGTAGACGG - Intergenic
1057447561 9:95128040-95128062 ATGCAAGAAAATAATTTGGCAGG + Intronic
1058114286 9:101067417-101067439 ATTCAATACAATATTCTTGAGGG - Intronic
1059025780 9:110627362-110627384 ATGCAAAACAATAAATTTGGGGG + Intergenic
1059488553 9:114646906-114646928 ATGCAAAAAATTAATCCAGATGG - Intergenic
1060038494 9:120279752-120279774 ATGTAAATCTATAATCTGGTGGG + Intergenic
1060946439 9:127571874-127571896 ATGGCAAAAAAAAATCTGGAGGG + Intronic
1203606344 Un_KI270748v1:60565-60587 ATGCAAAATAATAATCTCCAAGG + Intergenic
1185520444 X:734604-734626 ATGCAAAACCATCATTAGGATGG - Intergenic
1186090081 X:6037571-6037593 ATGCAGAACAATAATGCTGAAGG - Intronic
1186777995 X:12884603-12884625 ATGCACAACAATCATCTTTATGG + Intronic
1188025497 X:25204239-25204261 ATCCAATACAATTATCTGAATGG - Intergenic
1188091600 X:25971019-25971041 ATTCAAAACAATAAAGAGGAGGG + Intergenic
1189651306 X:43192609-43192631 GTCAAAAACAATAATCTAGATGG + Intergenic
1192434728 X:71136246-71136268 ATGAAAAACAATAAGCTGTTGGG - Intronic
1192757590 X:74062746-74062768 ATGCAAAACAAGTACCTGTAAGG - Intergenic
1195787051 X:108537581-108537603 ATGCAAAGCAATAACCTGACAGG - Intronic
1195805422 X:108760096-108760118 ATACAAGACAGTAATCAGGAAGG + Intergenic
1195819842 X:108932113-108932135 TTGCAAAATACTAATCTGGCAGG - Intergenic
1196033352 X:111115382-111115404 ATGCAAAACATTTGTCTGGTGGG + Intronic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1198156987 X:133970703-133970725 ATGCAAAAAAATGAGCTGGGGGG + Intronic
1199219762 X:145304696-145304718 ATGCAAAAGAAAAATCTTAAAGG - Intergenic
1199459693 X:148070865-148070887 ATGCAAAACAATAGTGAGGTAGG + Intergenic
1200322530 X:155204546-155204568 ATGCAAGAAAAGAATGTGGATGG - Intronic
1200860193 Y:7983158-7983180 TTCCAAAACATTAAACTGGATGG + Intergenic
1202024628 Y:20507754-20507776 AAGCCAAAGAATATTCTGGAAGG - Intergenic