ID: 1107076255

View in Genome Browser
Species Human (GRCh38)
Location 13:36324145-36324167
Sequence CATTCTTCCCAGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107076251_1107076255 -9 Left 1107076251 13:36324131-36324153 CCACAAGATCTTGACATTCTTCC 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 30
4: 295
1107076250_1107076255 16 Left 1107076250 13:36324106-36324128 CCTGCTATTCTGAATGTTAATCT 0: 1
1: 0
2: 0
3: 23
4: 224
Right 1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 30
4: 295
1107076249_1107076255 28 Left 1107076249 13:36324094-36324116 CCACAAACAGTGCCTGCTATTCT 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 30
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107076255 Original CRISPR CATTCTTCCCAGAGGGAAGT GGG Intronic
901678951 1:10902154-10902176 CATTCCTCCCACAGGGCTGTTGG - Intergenic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902274984 1:15332981-15333003 CATTATTCCAAGAGGTTAGTTGG - Intronic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
906035838 1:42749963-42749985 AAGGCTTCCCAGAGGGAAATGGG - Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
907489586 1:54800556-54800578 CAGTCCTCCCAGAGGGAGGTAGG + Intronic
907946026 1:59137403-59137425 CATGCTTCCCACAGAGAAGTGGG - Intergenic
908074242 1:60496588-60496610 CATTCTTCCTGGAAGGAATTTGG + Intergenic
908383867 1:63621909-63621931 CATTCTTGACAGAGGGCAGTTGG + Intronic
908754155 1:67452685-67452707 TGTTCTTCCCTGAAGGAAGTGGG + Intergenic
909406497 1:75296281-75296303 CATTTTTCCCATTGAGAAGTAGG - Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911042841 1:93605193-93605215 CATTCCTCCTAGAGAGAAGTCGG + Intronic
911386452 1:97181221-97181243 CTCTCATCCCAGAGGTAAGTTGG - Intronic
911387246 1:97192763-97192785 CATTCTTCCCAGTGGGAGTCTGG - Intronic
912942025 1:114053658-114053680 CATGCTTCCAAGGGGGCAGTAGG - Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
915448832 1:155990565-155990587 CAGTCTTCCCTGAGAGAAGGAGG + Intronic
915903614 1:159862946-159862968 CCTCCTTCCCTGGGGGAAGTGGG + Intronic
916590914 1:166189383-166189405 CTTTCTGCCCTGTGGGAAGTTGG + Intergenic
917530491 1:175830736-175830758 CATACTTCCCAGTGGGATGTAGG + Intergenic
919057394 1:192588177-192588199 CATTCTTCCCACATGGAGTTAGG + Intergenic
921641619 1:217561649-217561671 CATTTATCTCAGAGGAAAGTGGG - Intronic
922252564 1:223863408-223863430 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
922291313 1:224211064-224211086 CTTTCTTTCCAGTGGGAAGAGGG - Intergenic
1064244471 10:13657727-13657749 CATGATTCCCAGTGGGAAGTGGG + Intronic
1065875452 10:29993700-29993722 CATTCTTTCCACAGGAGAGTGGG + Intergenic
1066207679 10:33205756-33205778 CATTATTCCCAGAAGCAATTTGG + Intronic
1067276919 10:44844306-44844328 AATATTACCCAGAGGGAAGTGGG + Intergenic
1067288038 10:44921711-44921733 CATACTTCTCACAGGGCAGTGGG - Intronic
1067395903 10:45917112-45917134 CATTGGTCACATAGGGAAGTAGG - Intergenic
1067799616 10:49350024-49350046 CATTCATCCTACAGGGAAGTGGG - Intergenic
1067864227 10:49886237-49886259 CATTGGTCACATAGGGAAGTAGG - Intronic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1068638206 10:59370990-59371012 CATTCTTCTCATCAGGAAGTTGG - Intergenic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1074734935 10:116420845-116420867 CATTCTTCTCAGAGGCGAATAGG + Intergenic
1075589542 10:123681313-123681335 CTTTCCTCCCAGAGGGATGTGGG + Intronic
1076269534 10:129139462-129139484 CTTGCTTCCCAGAGGCAATTTGG + Intergenic
1077034555 11:488402-488424 CATTCTCCCCGGGGGGCAGTGGG + Intronic
1077292144 11:1802564-1802586 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
1081174220 11:39906893-39906915 CATAGATACCAGAGGGAAGTTGG + Intergenic
1081613501 11:44577380-44577402 AAGTCTTCCCTGAGGGAAGAAGG - Intronic
1084043251 11:66554869-66554891 CATTCCAGCCAGAGGGAAGCTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085529098 11:77181247-77181269 CATTCTTCCCAGCGGTCAGGAGG + Intronic
1086699392 11:89882802-89882824 CATTGTTTCCAGGGTGAAGTTGG - Intergenic
1086706779 11:89961712-89961734 CATTGTTTCCAGGGTGAAGTTGG + Intergenic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1088481165 11:110297048-110297070 AATTCTTCCCAGAGGGAGCCGGG + Intergenic
1088702331 11:112424552-112424574 CATTCTTCTGAAAGAGAAGTGGG + Intergenic
1088923080 11:114275954-114275976 CCTTCTTTCCAGAGAGAAGTGGG + Intronic
1091034228 11:132218660-132218682 ATTCCTTCCCAGAGGGAGGTAGG + Intronic
1091323931 11:134670165-134670187 ATTTCTTCGCAGTGGGAAGTAGG + Intergenic
1092742593 12:11644490-11644512 ATTTCTTCCAAGAAGGAAGTTGG - Intergenic
1093133659 12:15422588-15422610 CATTTTTCACAGAGGAAATTAGG + Intronic
1094339071 12:29389987-29390009 AAATCTTCCCAGAGGGTGGTGGG - Intergenic
1094499587 12:31010075-31010097 CACTCTTCCCTGAGAGAAGTGGG - Intergenic
1096805893 12:54140984-54141006 CATTCTTCCAAGGGGGGAGGAGG - Intergenic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1097287266 12:57887983-57888005 CGTTCTTCCCCCAGAGAAGTTGG + Intergenic
1098000103 12:65932118-65932140 TCTTCTTCCCAGAAGGAAGAGGG + Intronic
1100464565 12:94833854-94833876 CATGCTTGTCAGAGGAAAGTGGG - Intergenic
1101229199 12:102722478-102722500 CTTTCTTCCCAGAGCCAGGTAGG + Intergenic
1101366771 12:104079107-104079129 CAATCTTCCCATCAGGAAGTTGG - Intronic
1101407676 12:104443065-104443087 CATTCTTGTAAGAGGGAAGCAGG + Intergenic
1102510541 12:113412397-113412419 CATTCTCCCCAGAGTGACCTAGG - Intronic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1103880535 12:124162769-124162791 CATTTCTCCCAGAGGGGATTTGG - Intronic
1104059892 12:125258671-125258693 CATTCTTCCCACCAAGAAGTGGG - Intronic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1108558591 13:51620839-51620861 ACTGCTTCCAAGAGGGAAGTCGG + Intronic
1109832498 13:67810354-67810376 AATTCTTCCCAATAGGAAGTTGG + Intergenic
1109939340 13:69339778-69339800 CATTTTTCTCACAGGGAAATAGG - Intergenic
1110959256 13:81599908-81599930 GAGTCTTCCCAGAGGGAATTTGG - Intergenic
1111131186 13:83977833-83977855 CTCTCTTCCCACAGGGAAATAGG + Intergenic
1111848258 13:93539261-93539283 CATGCTTCTCAGTGGGATGTGGG + Intronic
1111898903 13:94176489-94176511 CATGCTTAGCACAGGGAAGTTGG - Intronic
1112308139 13:98293792-98293814 CTTTCTTCCCAGTGGGCAGGAGG - Intronic
1114058779 14:19000301-19000323 CATTCTCCTTAGAGAGAAGTGGG - Intergenic
1114103765 14:19401453-19401475 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
1116420290 14:44724246-44724268 CATTCTTTCCAGATGGAAAATGG - Intergenic
1116720900 14:48494450-48494472 CATTCTTTACAGTGAGAAGTAGG + Intergenic
1116984735 14:51206517-51206539 CATCCTTCAGAGAGGGAAGAGGG - Intergenic
1117736220 14:58771553-58771575 CATCCTTCTCAGAAGGAAATGGG + Intergenic
1119153542 14:72387699-72387721 AAGTCTTCACAGTGGGAAGTAGG + Intronic
1121176235 14:91892645-91892667 ACTTCTTCCCAGAGTGCAGTTGG + Intronic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121603178 14:95221172-95221194 CATTCTTCACAGAGGGGAGGGGG - Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122366026 14:101195276-101195298 ACTTGTTCCCAGAGGAAAGTGGG + Intergenic
1122687196 14:103514957-103514979 CAGTCCTCCCAGAGGGGATTCGG + Intergenic
1202836057 14_GL000009v2_random:77844-77866 CATTCTCCTTAGAGAGAAGTAGG - Intergenic
1123708018 15:22964614-22964636 CCTTTTTCCCAGAGGGAACATGG - Intronic
1125815416 15:42580162-42580184 CATTCCTCCCAGAGGAAAGAAGG + Intronic
1125979640 15:43988744-43988766 CATTCTCCTTAGAGAGAAGTGGG + Intronic
1126744477 15:51812248-51812270 CAGTCTTCCCTTAGGGAAATTGG - Exonic
1127964853 15:63915903-63915925 AATTGTTCCCAGAGGGAATGTGG + Intronic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1129885482 15:79034103-79034125 GAGGCTTCCCAGGGGGAAGTAGG - Intronic
1130179442 15:81610216-81610238 CATGTTTCCAAGAGGGAATTTGG - Intergenic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1130666552 15:85874239-85874261 CTTCCTTCCCAGTGGGGAGTGGG + Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1131117802 15:89805312-89805334 CATGCTTCCCAAAGGTGAGTGGG - Exonic
1131760425 15:95616736-95616758 CATTCTCCCCACAGGGTAATAGG - Intergenic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1132140031 15:99384768-99384790 CTTTCTTACTAGAGAGAAGTGGG - Intronic
1133103374 16:3492500-3492522 CATCCTGCCCAGAGGGACCTGGG + Intergenic
1133845275 16:9447700-9447722 CATTCTTCCCAGACTCATGTGGG - Intergenic
1133989305 16:10692280-10692302 CATTCTTCCCAGGGAGAATCTGG + Intronic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1135201195 16:20439069-20439091 CATACTTCCCACAGGGAGGAAGG - Intronic
1135217913 16:20588795-20588817 CATACTTCCCACAGGGAGGAAGG + Intergenic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1140583937 16:76265433-76265455 TTATCTTCCCAGAGAGAAGTTGG - Intergenic
1140681895 16:77393321-77393343 CATTCATCCAATAGGGAAGCAGG + Intronic
1141850727 16:86644034-86644056 CATTCTACACAAAGGGCAGTGGG - Intergenic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1143266348 17:5640873-5640895 CATTCCTCCCACTGAGAAGTGGG - Intergenic
1144102631 17:11955889-11955911 CATGCTTCCAAATGGGAAGTAGG + Intronic
1144856388 17:18270683-18270705 AATTCATCCCAAAGGGCAGTGGG + Intergenic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145903368 17:28502056-28502078 CATGCTTCCCAAAGGAAAGAGGG + Intronic
1145996279 17:29106685-29106707 CATTCCTCCTAGAAGGAAGGTGG - Intronic
1146176621 17:30669332-30669354 CCCTCTTCCTAGAGGGAAGGCGG - Intergenic
1146544206 17:33724396-33724418 CATTCTTTCCAGACGTAAGTCGG - Intronic
1146916242 17:36680188-36680210 TATTTTCCCCAGAGGGAAGCGGG + Intergenic
1147487814 17:40834920-40834942 CATTCTTACCAGAGGCCATTGGG + Exonic
1148796129 17:50197740-50197762 CATTCTTTCCAGGGGGACCTGGG + Exonic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151802679 17:76387063-76387085 CACTCTTCCTACAGGGAGGTAGG - Exonic
1157618658 18:49002807-49002829 CATTCTTCACAAAGGCATGTGGG - Intergenic
1158158870 18:54457259-54457281 CTTTCTTCTGGGAGGGAAGTAGG - Intergenic
1158614661 18:58975521-58975543 CATTCTTCCCGGAGAGCACTTGG - Intronic
1159190525 18:65036117-65036139 CATGCATCCCAGTGGGACGTAGG + Intergenic
1160758581 19:771476-771498 GCTTCTACCCAGAGGGAAATGGG - Intergenic
1162982199 19:14247555-14247577 CCCTCTTCCTAGAGGGAAGGCGG + Intergenic
1163797706 19:19346862-19346884 CACTCTTCATAGGGGGAAGTGGG - Intronic
1163889858 19:20001085-20001107 CATTCGTCCCAGTGGCAACTTGG + Intronic
1164293649 19:23889717-23889739 CATTCTTCCCATAGAGAAGATGG + Intergenic
1165636747 19:37346829-37346851 AAGGCTTCCCTGAGGGAAGTAGG - Intronic
1167412725 19:49354620-49354642 AATGTTTCCCAGAGGTAAGTGGG - Intronic
1167783109 19:51613376-51613398 AATGGTTCCCACAGGGAAGTTGG + Intronic
1202636578 1_KI270706v1_random:49518-49540 CATTCTCCTTAGAGAGAAGTAGG + Intergenic
925145504 2:1580810-1580832 GATTCTTCCCACAGAGAAGGGGG + Intergenic
925823007 2:7819076-7819098 AATTCTTCAGTGAGGGAAGTAGG + Intergenic
926041216 2:9674716-9674738 CATGCTTCCCAGAAGGGAGGAGG + Intergenic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
930152781 2:48075515-48075537 CATTCCTCCCATAGAGATGTGGG - Intergenic
930612862 2:53562745-53562767 AGATCTTCCCAGAGGGAGGTGGG + Intronic
930613034 2:53563989-53564011 AGATCTTCCCAGAGGGAGGTGGG + Intronic
931426799 2:62178863-62178885 GATTCTTCCCAGAGCCAAGCTGG + Intergenic
932063927 2:68533156-68533178 CATTCTTACATGAGGGAAGGTGG - Intronic
932570156 2:72934307-72934329 TATTATTCCCATAGGGAAGGGGG - Exonic
932835920 2:75036982-75037004 TATCATTCCCAGATGGAAGTGGG + Intergenic
935274566 2:101464916-101464938 CACCCTTATCAGAGGGAAGTGGG - Intronic
935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG + Intergenic
937263168 2:120599255-120599277 CATTCCTGCCAGCGGGAAGTGGG - Intergenic
938282415 2:130073916-130073938 CATTCTCCTTAGAGAGAAGTGGG + Exonic
938333045 2:130462488-130462510 CATTCTCCTTAGAGAGAAGTGGG + Exonic
938356764 2:130658183-130658205 CATTCTCCTTAGAGAGAAGTGGG - Intergenic
938433200 2:131264989-131265011 CATTCTCCTTAGAGAGAAGTGGG - Exonic
938477249 2:131627572-131627594 CATTCTCCTTAGAGAGAAGTGGG - Intergenic
939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG + Intronic
940636976 2:156309398-156309420 CCTTCTTCCCAGGGAGGAGTGGG + Intergenic
941945102 2:171087790-171087812 CACTATTTCCAGAGTGAAGTTGG - Intronic
942504407 2:176626474-176626496 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
942947673 2:181687329-181687351 CAGCCCTCCCAGAGGGAACTGGG + Intergenic
943071083 2:183141241-183141263 TATCCTTACAAGAGGGAAGTAGG - Intronic
943382963 2:187173376-187173398 CCTTCCTCCCAGAGGAAACTAGG - Intergenic
947750214 2:232528180-232528202 CAGTCTTCTCTCAGGGAAGTGGG + Intronic
948271168 2:236674294-236674316 CCTTCATACCAGAGGGATGTAGG - Intergenic
948752177 2:240139203-240139225 CGTGCTCCCCAGGGGGAAGTGGG + Exonic
1169179471 20:3550783-3550805 CTTTCCCCCCAGAGGGAAGGGGG - Intronic
1169494066 20:6096653-6096675 ATTTCTTCCTAGAGGTAAGTTGG - Intronic
1169568538 20:6882016-6882038 TGTTCTTCACTGAGGGAAGTGGG + Intergenic
1170467373 20:16635119-16635141 CATTCTTCCAAGAGGTAACCAGG - Intergenic
1170586195 20:17735833-17735855 CATTTTCCCCAGAGGGTGGTGGG - Exonic
1171024537 20:21616950-21616972 CATGCTGCCTGGAGGGAAGTCGG - Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1171882714 20:30630449-30630471 CATTCTCCTTAGAGAGAAGTAGG + Intergenic
1172091606 20:32436705-32436727 AGTTTTTCCCAGTGGGAAGTTGG + Exonic
1172581161 20:36050224-36050246 AAATCTTCCCAGAGGGTGGTGGG + Intergenic
1174180082 20:48669047-48669069 CATCCTTCCCAGAGGGCTGCAGG - Intronic
1174910214 20:54600103-54600125 CATTCCTTCCAGAAGGAAGATGG + Intronic
1175064602 20:56274123-56274145 CTTTCCTCCCAGAGGGAGCTGGG + Intergenic
1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG + Exonic
1178931847 21:36826066-36826088 CATAGTTCACAGAGTGAAGTTGG - Intronic
1180364292 22:11924795-11924817 CATTCTCCTTAGAGAGAAGTAGG - Intergenic
1180477264 22:15722917-15722939 CATTCTCCTTAGAGAGAAGTGGG - Intergenic
1181449741 22:23011592-23011614 TTTTCTTCCCAGAGGGCACTTGG + Intergenic
1182120197 22:27781493-27781515 CACCCTTCCCACAGGGTAGTGGG - Intronic
1183779912 22:39992815-39992837 CAATCTGCCCAGTGGGAACTGGG - Intergenic
1183910252 22:41073838-41073860 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
949356267 3:3183387-3183409 TCTTCATCCCAGATGGAAGTGGG - Intergenic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
951628014 3:24687941-24687963 CATTTTGCCCAGAGAGAATTTGG + Intergenic
951647657 3:24911175-24911197 CTTTCTTCCGAGAGAGAAGATGG - Intergenic
954611767 3:51948116-51948138 CAAGTTTCCCAGAGAGAAGTCGG + Intronic
956576682 3:70759987-70760009 CACTCCTGCCAGAGGGCAGTTGG - Intergenic
956950845 3:74280486-74280508 TATTCTACCCAGAGCTAAGTAGG - Intronic
958901220 3:99888439-99888461 GGTTCTTCCCAGAGAAAAGTTGG + Intronic
959299008 3:104575845-104575867 CACTCTTCCCCCAGGGAACTCGG + Intergenic
960475407 3:118118484-118118506 CCTTCTTCCCATAGGGAAGCAGG - Intergenic
960528444 3:118736767-118736789 AGTTCTTCCCATAGGTAAGTAGG + Intergenic
961577230 3:127847435-127847457 CATGCTTGACAGAGGGAAGGAGG + Intergenic
962226262 3:133612590-133612612 CATTTTTCCTAGAAAGAAGTTGG - Intronic
965521947 3:169677140-169677162 CATTCTTCCCATCGAGACGTGGG + Intergenic
968039186 3:195574087-195574109 CATTGTTCCCAGTGGCAACTGGG + Intronic
968691549 4:1992759-1992781 CTTCCTGCCCTGAGGGAAGTTGG + Intronic
968758229 4:2427730-2427752 CATTCTACCCCAAGGGAAGGTGG - Intronic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
970191596 4:13523703-13523725 GCTTCTGCCGAGAGGGAAGTGGG + Intergenic
972678960 4:41287367-41287389 AAATAGTCCCAGAGGGAAGTAGG - Intergenic
973043791 4:45509634-45509656 CATTCTTCCCAGGTGTAAATGGG - Intergenic
973366389 4:49212888-49212910 CATTCTCCTTAGAGAGAAGTAGG + Intergenic
973394220 4:49579546-49579568 CATTCTCCTTAGAGAGAAGTAGG - Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
983070060 4:163257226-163257248 CACTCTTCTCTGATGGAAGTAGG + Intergenic
984016758 4:174435842-174435864 TCTACTTCCCAGATGGAAGTGGG - Intergenic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
985420031 4:189775971-189775993 CATTCTTCCCATAGGAAAAATGG - Intergenic
1202763897 4_GL000008v2_random:135390-135412 CATTCTCCTTAGAGAGAAGTAGG + Intergenic
985828137 5:2207905-2207927 CCTTCTTTCCAGAGTGAACTTGG + Intergenic
987034148 5:14003617-14003639 CATTCTTCCCATTGAGAGGTGGG + Intergenic
987171996 5:15269024-15269046 AGTTTTTCCCAAAGGGAAGTAGG + Intergenic
987989264 5:25190291-25190313 AAATCTTCCCAGAGGGTGGTGGG + Intergenic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
990973471 5:61535654-61535676 CATGCTTCCCAGTGGGAATGTGG - Intronic
994359606 5:98835210-98835232 CACCCTTCCCAGAGTGAAGTGGG - Intergenic
995064085 5:107840847-107840869 CCCCCTTCCCAGAGGGACGTAGG - Intergenic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
995416987 5:111923423-111923445 CCTTCCTCCCAGAGGAAACTGGG - Intronic
995788808 5:115861249-115861271 AGTTGTTCCCAGACGGAAGTGGG + Intronic
995826140 5:116301909-116301931 CATTCTTCCCTAAAGGATGTGGG - Intronic
996220420 5:120925131-120925153 GATTCTTCACAGAGGGAAGGGGG + Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
997598153 5:135120887-135120909 CTTTGTTCCCAGTGGGAACTGGG + Intronic
1001281799 5:170391354-170391376 CATTCTTCCCAAGGGAAGGTGGG + Intronic
1001357261 5:171040633-171040655 CCTTCTTCCCAGGGAGAAGATGG + Intronic
1001549196 5:172590102-172590124 CACTCTTCCCAGCATGAAGTAGG + Intergenic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1002375301 5:178784615-178784637 CATTCTTACCAGCAGGAAGGAGG - Intergenic
1002777320 6:340329-340351 CAGTCCACCCAGAGGTAAGTGGG - Intronic
1003435376 6:6083170-6083192 CATGCTTCCCAGATGGGAGCTGG - Intergenic
1004770777 6:18778662-18778684 CATTCTTTCCAAAAGGAAGATGG - Intergenic
1005627839 6:27680224-27680246 CGTTCCTCCCAGTGGGAATTCGG - Intergenic
1005700286 6:28393870-28393892 TAATCTTCCCAGAGAGAAGTGGG - Intronic
1005778684 6:29165574-29165596 AAATCTTCCCAAAGGGTAGTGGG + Intergenic
1006414528 6:33895618-33895640 CCTTCTGCCCAGAGGGAATTTGG - Intergenic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1006832519 6:36977446-36977468 AATTCTTTCCAAAGGGAGGTGGG - Intronic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1007234425 6:40380026-40380048 CATCCTTCAAAGGGGGAAGTGGG - Intergenic
1007653698 6:43439098-43439120 AAGCCTTCCCAGTGGGAAGTGGG - Intronic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1008855343 6:56079203-56079225 AATTCTTCTCAGAAGGAAGGTGG + Intronic
1011526888 6:88275561-88275583 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
1012345310 6:98178834-98178856 CATTCCTCCCAGAAGCAAGAAGG + Intergenic
1012897981 6:104973537-104973559 CTTCCTTCCCAAAGGGGAGTGGG - Intronic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014922164 6:127226030-127226052 CATTCTTCCTATAGGGAGGTAGG - Intergenic
1016538956 6:145141377-145141399 CTTTCTTCCTAAAGGGAAATTGG + Intergenic
1019898712 7:4002933-4002955 CTTCCTTCCCAGAGGGCACTGGG + Intronic
1020124800 7:5527422-5527444 CATTCTCCTTAGAGAGAAGTGGG + Exonic
1021474927 7:21050122-21050144 CAATCTTTCCAGTGAGAAGTGGG - Intergenic
1022261087 7:28705594-28705616 CATTTTCCCCAGAGGGACTTGGG - Intronic
1023362763 7:39432708-39432730 CACTCTTCCCAGGTGGAAGAGGG + Intronic
1024013177 7:45287960-45287982 CCTCCTTCCCAGAGGCCAGTGGG + Intergenic
1024673915 7:51621189-51621211 GTTTCTTCCCAGGGGGAAGCCGG - Intergenic
1026658464 7:72277735-72277757 CATTTCTCCCAGAAGGAAGATGG - Intronic
1028087135 7:86650128-86650150 AGTTCTTCACACAGGGAAGTTGG - Intronic
1028336163 7:89658725-89658747 AAGTTTTCCCAGAGGGTAGTTGG + Intergenic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1029385699 7:100242104-100242126 TTTTCTTCCCAGAGGAAAATCGG + Intronic
1032271772 7:130415158-130415180 CATTATTAGCAAAGGGAAGTTGG + Intronic
1032354680 7:131199547-131199569 CTTTCTTCTCCAAGGGAAGTGGG - Intronic
1034705071 7:153134541-153134563 CATTCTTGCCAGTGGTAAGGTGG + Intergenic
1036223688 8:6941196-6941218 CACTCCTCCCTGAAGGAAGTGGG - Intergenic
1037797432 8:22008268-22008290 CATTTTTTCCAGTGGGGAGTTGG - Intergenic
1038919064 8:32062249-32062271 CATTCTTCCCATGAGGAAGCAGG - Intronic
1040409923 8:47143791-47143813 CATGCTTCCCAGGGTGAGGTGGG - Intergenic
1041198762 8:55428844-55428866 AATTCTTCCCAAATGGATGTGGG + Intronic
1042999352 8:74738261-74738283 TATTCTTGCCAGAGAGGAGTTGG - Intronic
1043578986 8:81689936-81689958 CATCCTTCCCAGTGGGCAATAGG + Intergenic
1043661374 8:82746446-82746468 TGTTCTTCCCAGAGAGAAGGAGG + Intergenic
1043827815 8:84949988-84950010 CATTCTTCTTAGAGAGAAGTGGG - Intergenic
1044187806 8:89277379-89277401 AAATCTTCCCAGAGGAGAGTAGG - Intergenic
1044319818 8:90790024-90790046 CATTCTTCCTATAGAGAAGTGGG - Intronic
1049162423 8:141105899-141105921 GATTCTTCCCAGAAGGGCGTGGG - Intergenic
1049595691 8:143482302-143482324 CATTTTCCCCAGTGGTAAGTAGG - Intronic
1050631359 9:7561948-7561970 CATTTTTCCAAGAGGAAAGATGG + Intergenic
1054958011 9:70935325-70935347 CATGCTTCCAAGAGTGAATTGGG - Intronic
1056237643 9:84611005-84611027 CATTCTTCCCATAAAGAGGTAGG - Intergenic
1056720022 9:89063540-89063562 CCTACTTCCCAGAGGGATGAAGG + Intronic
1057861742 9:98646161-98646183 CATTCTTATCAGAGGGGAGTGGG - Intronic
1058084365 9:100732666-100732688 CATTCTCCTTAGAGAGAAGTGGG - Intergenic
1059204951 9:112455872-112455894 CATTCTACTAAGAGGGAAGGAGG - Intronic
1059263248 9:112999878-112999900 CTTCCTTCCCAGAGGTTAGTTGG + Intergenic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1203544645 Un_KI270743v1:120263-120285 CATTCTCCTTAGAGAGAAGTAGG + Intergenic
1185882105 X:3750691-3750713 CATCCTTATAAGAGGGAAGTAGG + Intergenic
1186371165 X:8948930-8948952 CTTTCTTCTCAGAGAGAAGCAGG + Intergenic
1187555959 X:20351345-20351367 CACTCTTCCCAGACTAAAGTTGG - Intergenic
1188169686 X:26909780-26909802 CACTCTTTTCAGAGGCAAGTGGG + Intergenic
1189812624 X:44794620-44794642 CATTCTCCTTAGAGAGAAGTGGG - Intergenic
1189957163 X:46287671-46287693 CATTCTCCTTAGAGAGAAGTGGG + Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1191662502 X:63665851-63665873 CCTTCTTCCCTGAGGGAGATGGG - Intronic
1192211614 X:69131434-69131456 GGTTCTTCCCAGCTGGAAGTCGG - Intergenic
1193397513 X:81003498-81003520 AAATCTTCCCAGAGGGTGGTGGG + Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1197511329 X:127372292-127372314 CTTTCTTCCCAGAGGTCAGATGG + Intergenic
1197540304 X:127751431-127751453 CATTCTGTCCATTGGGAAGTAGG - Intergenic
1197719474 X:129735391-129735413 AATTCTGCCCTGAGGGCAGTGGG + Intergenic
1198319889 X:135510316-135510338 CACTCTTCCCACTGGGAGGTGGG - Intergenic
1200782869 Y:7232515-7232537 CATCCTTATAAGAGGGAAGTAGG - Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201771574 Y:17621458-17621480 AATTCTTCCCAGATGGTATTGGG + Intergenic
1201829981 Y:18284528-18284550 AATTCTTCCCAGATGGTATTGGG - Intergenic