ID: 1107078074

View in Genome Browser
Species Human (GRCh38)
Location 13:36345650-36345672
Sequence CAGGCCCAGAATTAAGTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107078072_1107078074 -6 Left 1107078072 13:36345633-36345655 CCAAGAGAAACTTTTCTCAGGCC 0: 1
1: 0
2: 3
3: 23
4: 180
Right 1107078074 13:36345650-36345672 CAGGCCCAGAATTAAGTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107078074 Original CRISPR CAGGCCCAGAATTAAGTCGG AGG Intronic
903992582 1:27284145-27284167 CAGGCCCACATTTAATTCTGTGG - Intronic
905731393 1:40301426-40301448 CAGGCCCAGAATTTTGAAGGTGG + Intronic
914446952 1:147758426-147758448 CAGGCACTGATTAAAGTCGGGGG + Exonic
916215480 1:162389858-162389880 CAGGCTCAGGATAAAGTGGGGGG - Intergenic
916871681 1:168921473-168921495 GAGGCCCAGATTTGAGTCAGAGG + Intergenic
919665860 1:200291164-200291186 CAGGAGCAGAATAAAGTCGCTGG - Intergenic
920416407 1:205801593-205801615 CAGGCTCTGAATTAAGACTGTGG + Intronic
924634924 1:245776937-245776959 CAAGAGCAGAATTAAGTAGGAGG + Intronic
924758357 1:246962513-246962535 GAGGACCTGAATTAAGTCAGTGG - Intronic
1071491202 10:86137734-86137756 CAGGCCCCGAATCACGCCGGTGG - Intronic
1073135042 10:101215739-101215761 CACCCCCTGAATTCAGTCGGGGG + Intergenic
1073533291 10:104252925-104252947 CAGGCTCAGAATCAAGCAGGTGG - Intronic
1075023241 10:118966507-118966529 CAGGCCCAGAACTCAGTGTGTGG - Intergenic
1077147337 11:1052085-1052107 AAGGCCCAGAATTAGGTACGTGG - Intergenic
1077992738 11:7426389-7426411 CAGGCCAAGCATTGAGTGGGAGG - Intronic
1078519432 11:12051371-12051393 CAGGCACAGAATTAAGTCACTGG - Intergenic
1083817883 11:65147384-65147406 CAAGTCCAGAATTAAGGGGGTGG - Intergenic
1085109759 11:73877076-73877098 CAGGCCCAGAACAGAGTCAGAGG + Intronic
1086263008 11:84963286-84963308 CAGTCACAGAATCAAATCGGAGG + Intronic
1089405403 11:118193574-118193596 CAGACCAAGAATTAAATCAGTGG + Intergenic
1090969539 11:131628546-131628568 CAGGCCCAAAATAAAGTTGAAGG - Intronic
1092256779 12:6930298-6930320 CAGGTCCAGAATGATGTTGGGGG + Intronic
1094396721 12:30014673-30014695 CAGGTCCAGAAGCAAGTCGTGGG + Intergenic
1095957969 12:47817494-47817516 CAGGGCCTGAATAAAGTCTGGGG - Intronic
1096880205 12:54661370-54661392 CAGGCCCTGAAAGAAGACGGGGG - Intergenic
1097159901 12:57038750-57038772 CAGGCCCAGACTGAAGTCAATGG - Intronic
1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG + Intronic
1107078074 13:36345650-36345672 CAGGCCCAGAATTAAGTCGGAGG + Intronic
1109259749 13:60130309-60130331 TAGGCCCAGAATTTAGTCCAGGG - Intronic
1113291010 13:108906186-108906208 CATTCCCAGAAATAAGTGGGAGG + Intronic
1113948684 13:114059288-114059310 CAGGGCCTGAATTAGGTTGGGGG - Intronic
1117551961 14:56845571-56845593 CAGGCCCAGAATTCTATCGTTGG + Intergenic
1121950730 14:98168658-98168680 GATGCCCAGAATTCAGTCAGAGG + Intergenic
1125750295 15:42023272-42023294 CAGGGCCAGAACCAAGTTGGTGG - Intronic
1126666515 15:51080452-51080474 CATGCCCAGACTTGAGTTGGGGG - Intronic
1128537498 15:68501952-68501974 CAGACCCAGAGATAAGTGGGTGG - Intergenic
1140884970 16:79235003-79235025 CAGGCTATGAATTAAGTCCGTGG - Intergenic
1153202222 18:2657366-2657388 CAGGCACAGAATTAACTTGAGGG - Intronic
1163843800 19:19627812-19627834 CGGCCCCAGAAGTTAGTCGGCGG + Exonic
1165102888 19:33449282-33449304 CAGGCCCAGAAGAAAGGGGGAGG - Intronic
927885240 2:26714268-26714290 CAGGCCCAGAATCAAGAGGCTGG + Intronic
930525788 2:52527698-52527720 CAGGCAGAGAATTAAGTTGGAGG + Intergenic
930864167 2:56106327-56106349 CAGCCCCAGAATTAAGCATGGGG - Intergenic
934809920 2:97269490-97269512 CAGTCCCAGAATAAAGGCGGGGG - Intergenic
934827772 2:97438449-97438471 CAGTCCCAGAATAAAGGCGGGGG + Intergenic
935535048 2:104284165-104284187 TAGGCCCAGAATGAAGAAGGGGG - Intergenic
943283384 2:185965570-185965592 CAGGCCCAGAAATTAGTCTTGGG + Intergenic
1172004788 20:31811630-31811652 CATTCCCAGAATGAAGACGGAGG + Intergenic
1175275313 20:57764570-57764592 GAGGCCAAGAATTAAGGCTGTGG + Intergenic
1181434058 22:22900173-22900195 CAGACCCAGAATGAGGTAGGAGG + Intergenic
1181434996 22:22905539-22905561 CAGACCCAGAATGAGGTAGGAGG + Intergenic
1182048012 22:27291308-27291330 CATGCCCAGATTTAAGGCAGTGG + Intergenic
1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG + Intronic
953912585 3:46900407-46900429 CAGGCCTAGAGTCAAGTTGGTGG + Intronic
960294455 3:115926165-115926187 CGTGCCCAGAATTAAGACAGAGG - Intronic
962184320 3:133242361-133242383 CAGGCCAAGAAGTAAGTAGAAGG + Intronic
963527229 3:146430024-146430046 CAGGCGCGGAATTTAGTGGGGGG - Intronic
969316250 4:6383037-6383059 CAAGCCCAGAATCAAGGTGGGGG - Intronic
985364332 4:189211118-189211140 CAGGACCAGAATCAAGAAGGAGG - Intergenic
1004352092 6:14898845-14898867 CAGGCCCAGAATAAAGCCAAGGG - Intergenic
1005812998 6:29530585-29530607 CAGCCACAGAATTAAGTCCCTGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007592352 6:43030041-43030063 GGGGCCCAGATTTAAGTGGGAGG - Intronic
1009406509 6:63320458-63320480 AAGGTCCAGAATTAATTTGGAGG - Intergenic
1016179295 6:141124293-141124315 CAGGACCAGGACCAAGTCGGAGG - Intergenic
1018068025 6:160137255-160137277 CAGGCCCAGAGTGCAGTTGGGGG - Intronic
1032260264 7:130330445-130330467 CATGCCCAGACTTAAGGCGATGG + Intergenic
1032363336 7:131276176-131276198 CAGGCCCAGAATAAAGGAGAGGG - Intronic
1035051662 7:156002312-156002334 CAGGCCCAGAGGGAAGTAGGTGG + Intergenic
1037227398 8:16609627-16609649 CAAGCAGAGAATTAAGTCAGAGG + Intergenic
1045469189 8:102496268-102496290 AAGGCCAAGAATTAAGCAGGGGG + Intergenic
1048955634 8:139533794-139533816 CAGGGCCAGAAGTAAGTTGAGGG + Intergenic
1052913402 9:33904789-33904811 GAGGCCCAGGATTAAATTGGTGG + Intronic
1060892688 9:127198719-127198741 CAGGCCCAGAAGAAAGCCTGAGG + Intronic
1186695908 X:12031801-12031823 CAGGGCCAGAATGGAGTCAGAGG + Intergenic
1189430788 X:40945087-40945109 TAAGCCCAGAATGAAGACGGGGG + Intergenic
1201439671 Y:13994163-13994185 TTGGCCCAGAATTAGCTCGGAGG + Intergenic
1201444900 Y:14048545-14048567 TTGGCCCAGAATTAGCTCGGAGG - Intergenic