ID: 1107080510

View in Genome Browser
Species Human (GRCh38)
Location 13:36369773-36369795
Sequence ATGAAGTCTCTATAAATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107080510_1107080515 25 Left 1107080510 13:36369773-36369795 CCAAATATTTATAGAGACTTCAT 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1107080515 13:36369821-36369843 CTGTAGGAAGAGTAAAGCCATGG 0: 1
1: 0
2: 1
3: 15
4: 228
1107080510_1107080513 9 Left 1107080510 13:36369773-36369795 CCAAATATTTATAGAGACTTCAT 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1107080513 13:36369805-36369827 GGCAGTGAACTCCACACTGTAGG 0: 1
1: 0
2: 0
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107080510 Original CRISPR ATGAAGTCTCTATAAATATT TGG (reversed) Intronic