ID: 1107080510 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:36369773-36369795 |
| Sequence | ATGAAGTCTCTATAAATATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 344 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 30, 4: 311} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107080510_1107080515 | 25 | Left | 1107080510 | 13:36369773-36369795 | CCAAATATTTATAGAGACTTCAT | 0: 1 1: 0 2: 2 3: 30 4: 311 |
||
| Right | 1107080515 | 13:36369821-36369843 | CTGTAGGAAGAGTAAAGCCATGG | 0: 1 1: 0 2: 1 3: 15 4: 228 |
||||
| 1107080510_1107080513 | 9 | Left | 1107080510 | 13:36369773-36369795 | CCAAATATTTATAGAGACTTCAT | 0: 1 1: 0 2: 2 3: 30 4: 311 |
||
| Right | 1107080513 | 13:36369805-36369827 | GGCAGTGAACTCCACACTGTAGG | 0: 1 1: 0 2: 0 3: 12 4: 189 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107080510 | Original CRISPR | ATGAAGTCTCTATAAATATT TGG (reversed) | Intronic | ||