ID: 1107080513

View in Genome Browser
Species Human (GRCh38)
Location 13:36369805-36369827
Sequence GGCAGTGAACTCCACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107080510_1107080513 9 Left 1107080510 13:36369773-36369795 CCAAATATTTATAGAGACTTCAT 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1107080513 13:36369805-36369827 GGCAGTGAACTCCACACTGTAGG 0: 1
1: 0
2: 0
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107080513 Original CRISPR GGCAGTGAACTCCACACTGT AGG Intronic