ID: 1107083648

View in Genome Browser
Species Human (GRCh38)
Location 13:36402561-36402583
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 2, 1: 1, 2: 3, 3: 29, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107083643_1107083648 14 Left 1107083643 13:36402524-36402546 CCCGATGTTTCTTTGTTGATTTT No data
Right 1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG 0: 2
1: 1
2: 3
3: 29
4: 205
1107083644_1107083648 13 Left 1107083644 13:36402525-36402547 CCGATGTTTCTTTGTTGATTTTC 0: 163
1: 369
2: 1070
3: 1074
4: 1810
Right 1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG 0: 2
1: 1
2: 3
3: 29
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107083648 Original CRISPR TGTCCAATGCTGAAAGTCAG GGG Intergenic
900784810 1:4642376-4642398 TGTCTAATGCTGAAAGCCATTGG + Intergenic
904639514 1:31913989-31914011 TGTCCACTGCTGGAAATCACTGG - Intronic
905961320 1:42044892-42044914 TGTCCAATAATGAAGGTCAGTGG - Intergenic
907924103 1:58939978-58940000 AGTCCAAGGCACAAAGTCAGAGG - Intergenic
911539691 1:99144060-99144082 TGTCCAAGGCTTAAAGTCACTGG - Intergenic
911615667 1:100007989-100008011 TGTCCCAGGCTGGAAGGCAGTGG + Intronic
912531503 1:110327169-110327191 TGTCCAGTGGTGGCAGTCAGTGG + Intergenic
913166530 1:116192223-116192245 TGTGGAGTGGTGAAAGTCAGGGG + Intergenic
915167626 1:153957471-153957493 TTTCCAAGGCTGGAGGTCAGAGG - Intronic
915767294 1:158375608-158375630 TATTTAATGCTGAGAGTCAGGGG - Intergenic
915910353 1:159911102-159911124 AGTCCAATGCTGTCAGTCTGAGG + Intergenic
916451641 1:164926644-164926666 TGGACAATGCTGAAAGCCAAAGG + Intergenic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
916964140 1:169917903-169917925 AGTCCAAGGCTGGAAGTCTGAGG - Intergenic
917469488 1:175314338-175314360 TGACCAAAGCTGAGAGGCAGTGG + Intergenic
921496581 1:215849774-215849796 TGTCAAATGTTGAAAGACAATGG + Intronic
921538167 1:216378327-216378349 TGTCCATTGCTGTAAGTCTTAGG - Intronic
923549491 1:234951384-234951406 TATTGAATGCTGAAAGTCATGGG + Intergenic
924808780 1:247382981-247383003 TGCTCAATGCTGTAACTCAGTGG - Intergenic
1062979228 10:1708070-1708092 TATGCAATGCTGGAAGGCAGAGG + Intronic
1063076880 10:2725805-2725827 TTTCCAATGGTTTAAGTCAGTGG - Intergenic
1064538972 10:16387124-16387146 TGACCAATGCTAAGAGGCAGCGG - Intergenic
1064973718 10:21091663-21091685 TGTCCAAGGCTGAAGTACAGTGG + Intronic
1065399973 10:25288030-25288052 TTTCCATTACTGAAAGTTAGGGG + Intronic
1065784105 10:29197185-29197207 TGTCCAATGTCTAAAGTCTGAGG - Intergenic
1066693699 10:38059320-38059342 AGTACAATGCTGAAAAGCAGTGG - Exonic
1066999117 10:42589830-42589852 AGTACAATGCTGAAAAGCAGTGG + Exonic
1067815332 10:49471239-49471261 TTTCCAAGGCTGAAAGTTTGGGG - Intronic
1067987136 10:51162756-51162778 TTTCCCATGCTGGAATTCAGTGG + Intronic
1069463661 10:68618482-68618504 AGCCCAATGCTGAAAGTCAATGG + Intronic
1070566804 10:77609877-77609899 TGTCCACTGCTGACAGGCTGTGG - Intronic
1071300209 10:84250752-84250774 TTTCTAAAGCTGAAAGTCTGAGG + Intronic
1072657706 10:97341929-97341951 TGTTAAATGCTGAAATTCTGAGG + Intergenic
1073165164 10:101441404-101441426 GGTCCAATGCTGAAATTCTATGG - Intronic
1075103714 10:119523679-119523701 AGTCCTATGCTGGATGTCAGGGG + Intronic
1076332407 10:129680047-129680069 TGTACAATGGTGCAATTCAGTGG + Intronic
1078450409 11:11436680-11436702 TGTACATTGCTGAAGGGCAGGGG + Intronic
1078615955 11:12866604-12866626 GGCCCAGGGCTGAAAGTCAGGGG - Intronic
1083941158 11:65896664-65896686 TGCCCAAGGCTGAAAGTGATAGG - Intronic
1088261854 11:107951657-107951679 TCACCAACGCTGAAATTCAGTGG + Intronic
1089142229 11:116294772-116294794 TGTCCTGTGATTAAAGTCAGTGG + Intergenic
1094862089 12:34478859-34478881 TGTCTAATGTTGACAGACAGTGG - Intergenic
1099781902 12:87205911-87205933 TGTCCAATGTTGAAGGTAGGAGG - Intergenic
1099930284 12:89066310-89066332 TCTCCCAGGCTGAAAGGCAGTGG - Intergenic
1103119977 12:118372426-118372448 GGTCCAAGACTGAAAGTCTGAGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104661484 12:130613996-130614018 TTTCTCATGCAGAAAGTCAGAGG - Intronic
1105296685 13:19093270-19093292 TCTCCCATGCTGAAAGTCTTGGG - Intergenic
1107068417 13:36242958-36242980 TGCCCAATTCTGACAGTAAGTGG + Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107344687 13:39446497-39446519 TGTCCCATGCTGAATGTCCTAGG - Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1108916304 13:55617096-55617118 TGCTCAATGCACAAAGTCAGAGG - Intergenic
1109112497 13:58339720-58339742 TGCTCAATGCTGAAAGTAAAGGG + Intergenic
1110158968 13:72352629-72352651 TGCCCTATGCTAAAAGGCAGAGG - Intergenic
1111781106 13:92725907-92725929 TGTGCTACGCTAAAAGTCAGAGG - Intronic
1111846665 13:93517877-93517899 TATTCAATGCTTAAAATCAGTGG + Intronic
1112192582 13:97192390-97192412 TGTCAAATGCAAACAGTCAGAGG + Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117521484 14:56555914-56555936 TATCCAATGCTCAAAGCCAAAGG - Intronic
1117771783 14:59140858-59140880 TGACGAATGCTAAAAGGCAGAGG + Intergenic
1117795103 14:59385321-59385343 TCTCCAATGATGAAAGTGAGGGG + Intergenic
1118046245 14:61974519-61974541 TGTGGAATGCTGTAAGGCAGAGG + Intergenic
1118520218 14:66575227-66575249 TGAAAAATGCTGAAAGTGAGAGG - Intronic
1119970438 14:78964301-78964323 TGTCTAATTCTGAAGTTCAGTGG - Intronic
1123519624 15:21059974-21059996 TTTCCCAGGCTGAAGGTCAGTGG + Intergenic
1126677028 15:51169066-51169088 GGACCAATGCTCAAAGTCACTGG - Intergenic
1128853199 15:70983285-70983307 GCTCCAATGCTGGAAGTCAGTGG + Intronic
1133997213 16:10757624-10757646 TGGTCTATGCTGTAAGTCAGTGG - Intronic
1137967868 16:52954784-52954806 TGTCCATTTCTGAATGTCATGGG + Intergenic
1141237522 16:82232374-82232396 AGTTCAAGGCAGAAAGTCAGGGG + Intergenic
1141626057 16:85261662-85261684 TGGACACTGCCGAAAGTCAGTGG - Intergenic
1141948965 16:87328481-87328503 TGTCCACTGCTGAGTGTGAGTGG - Exonic
1146234792 17:31148675-31148697 TTTCCCATGCTGAAAGTCTTGGG + Intronic
1148405768 17:47413742-47413764 TTCCCAATTCTGAAAGACAGTGG - Intronic
1150183485 17:63153691-63153713 TGAACAATGCTGAAAGTCTTTGG + Intronic
1150290976 17:63981844-63981866 TGTCCAATGCTGGAAAGCTGTGG - Intergenic
1157518144 18:48325734-48325756 TGTCCCATGCTGACATTCCGTGG - Intronic
1159575462 18:70170674-70170696 TGTCCTCTGCTGAAAGCCACTGG + Intronic
1160751672 19:737297-737319 TGTGCACTGCACAAAGTCAGTGG - Intronic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166450730 19:42898410-42898432 TGTCAAATCCTGAAAGTAAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
925362580 2:3289763-3289785 TGTCCAAAGCTGAACGCCAGCGG + Intronic
926252487 2:11163442-11163464 TGCCCTGTGCTAAAAGTCAGTGG - Intronic
926331323 2:11828397-11828419 GGTCCAATGCTGATGGTCAATGG - Intergenic
926478893 2:13363351-13363373 TGTCCAATGCTGAATGTGCAGGG - Intergenic
927022256 2:19029422-19029444 TGTCCAATCATGGCAGTCAGAGG - Intergenic
931725047 2:65101506-65101528 TGTCCATTGCTTGAAGTCAAAGG - Intronic
932965861 2:76473896-76473918 TGCCCAGTGCTGTAGGTCAGTGG + Intergenic
933068494 2:77829636-77829658 TATCCCAGGCTGAAAGGCAGTGG - Intergenic
933600544 2:84325308-84325330 TGTTCAAAGTTGGAAGTCAGTGG + Intergenic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
935207540 2:100909566-100909588 TGTCCAATGCTGAGGGCCCGGGG - Intronic
935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG + Intergenic
935865062 2:107378689-107378711 TGTGCAATACTGAAATGCAGTGG + Intergenic
937304067 2:120860452-120860474 TGTCCATTGCAGAAGCTCAGAGG + Intronic
939397901 2:141654940-141654962 TGTACAATGCTGAAATGCTGAGG + Intronic
939472257 2:142637950-142637972 TGTCCATTTCTGAAAGTCCTAGG - Intergenic
939705578 2:145448397-145448419 TGACTAATGCTGATAGTTAGAGG + Intergenic
940498901 2:154469797-154469819 TGTCCAGTCGTTAAAGTCAGTGG + Intergenic
940852008 2:158696699-158696721 AGTACAATGTTGAAAATCAGTGG - Intergenic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
942824525 2:180158874-180158896 AGTGAAATGATGAAAGTCAGTGG - Intergenic
946687509 2:222285843-222285865 TTTTAAATGCTGAAAATCAGTGG + Intronic
948666950 2:239541776-239541798 TGTCTAATTCTGAAAGACAGAGG - Intergenic
1169210983 20:3766249-3766271 TGTCCAGTCCTGAGAGTCAGCGG - Intronic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1173337039 20:42120654-42120676 TGTCCAATGATGAAGGTTATGGG - Intronic
1174193806 20:48758616-48758638 TGTGCAGGGCTGAAGGTCAGAGG + Intronic
1179986724 21:44926295-44926317 TGCACAAGGCTGGAAGTCAGAGG + Intronic
1180825665 22:18859133-18859155 TGTCCATTGCTAAGACTCAGAGG - Intronic
1180859144 22:19067139-19067161 TCCCCAGTGCTGAAAGTCTGGGG + Intronic
1181013174 22:20054031-20054053 TGGCCAATGCTGTTAGTCCGGGG + Intronic
1181187067 22:21115414-21115436 TGTCCATTGCTAAGACTCAGAGG + Intergenic
1181212134 22:21295079-21295101 TGTCCATTGCTAAGACTCAGAGG - Intergenic
1181397360 22:22631801-22631823 TGTCCATTGCTAAGACTCAGAGG + Intergenic
1181500110 22:23311176-23311198 TGTCCATTGCTAAGACTCAGAGG + Intronic
1181652044 22:24264255-24264277 TGTCCATTGCTAAGACTCAGAGG - Intergenic
1181705333 22:24646488-24646510 TGTCCATTGCTAAGACTCAGAGG + Intergenic
1182928547 22:34151084-34151106 GGTTCAGTGATGAAAGTCAGAGG + Intergenic
1182963705 22:34502130-34502152 TGTCTAATGCAGAAGGTCTGGGG - Intergenic
1184609418 22:45593173-45593195 TTTCAAATGATGAAAGTCAGTGG - Intronic
1203214822 22_KI270731v1_random:353-375 TGTCCATTGCTAAGACTCAGAGG + Intergenic
1203275813 22_KI270734v1_random:85039-85061 TGTCCATTGCTAAGACTCAGAGG - Intergenic
952117306 3:30198191-30198213 TTGGCAAGGCTGAAAGTCAGAGG + Intergenic
952426290 3:33177997-33178019 AGTACAATGCTGAAAAGCAGTGG + Intronic
953758640 3:45669004-45669026 AGTCAAATGCAGAAAGCCAGAGG + Intronic
954094220 3:48311354-48311376 AGTCCAATGTTGAATCTCAGTGG - Intronic
956167665 3:66408610-66408632 AGTCCAATTCTTAAAGTGAGGGG - Intronic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
959728368 3:109571628-109571650 TGTCAAATGCTAAATTTCAGTGG - Intergenic
960096987 3:113698481-113698503 TTGCCAAGGCTGAAGGTCAGTGG + Intergenic
961060339 3:123823302-123823324 TGTCAAATTCTGGAGGTCAGTGG - Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969103459 4:4787428-4787450 TGCCCTCTGCTGTAAGTCAGGGG + Intergenic
970930469 4:21505651-21505673 TTTTGAGTGCTGAAAGTCAGGGG - Intronic
971119342 4:23686835-23686857 TGTTAAATTCTGAAAATCAGAGG - Intergenic
971701571 4:29984352-29984374 TGTCCTTTGCTTTAAGTCAGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
974109917 4:57513006-57513028 TCTGCTATGCTTAAAGTCAGGGG - Intergenic
975314784 4:72939193-72939215 TGCCCAAAGCAGAAACTCAGAGG + Intergenic
975740048 4:77420874-77420896 TGTCCCAGCCTGAGAGTCAGGGG + Intronic
975760811 4:77618077-77618099 TGGCCAATGATGGGAGTCAGGGG - Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977631113 4:99244288-99244310 TGTCCTATGCTGAATTTCAAAGG + Intergenic
978875376 4:113634528-113634550 AGTCCAATGCTGGCAGTCACAGG + Intronic
980026680 4:127776344-127776366 TGGCCAAAGCTGTAGGTCAGTGG - Intergenic
980691589 4:136302326-136302348 TGTCTTATGATTAAAGTCAGTGG - Intergenic
980758240 4:137193005-137193027 TGTCCAGTGGTAAAAGTTAGTGG + Intergenic
982711712 4:158764644-158764666 TGTCTAATGCAAAAAGACAGAGG + Intergenic
982806686 4:159773803-159773825 TGTTCAATGCTGAAAGCAAATGG - Intergenic
982989963 4:162261080-162261102 TGTCCATTTCTGAAACTCGGAGG - Intergenic
984853631 4:184174786-184174808 TATACAAGCCTGAAAGTCAGTGG + Intronic
985199043 4:187465154-187465176 TGTCCAATTAGGAAATTCAGTGG + Intergenic
987638230 5:20575482-20575504 TGTTCAATGCTGGAAGAAAGTGG + Exonic
991207911 5:64071097-64071119 TGTCCATTGAAGAAAGTAAGGGG - Intergenic
993423541 5:87733178-87733200 TTTCCAATTCTGAAAATTAGTGG + Intergenic
994880396 5:105486314-105486336 TGGCCAATGCAAAAAGACAGTGG + Intergenic
997528225 5:134567018-134567040 TAACCCATGCTGAAAGCCAGGGG + Intronic
997857848 5:137389468-137389490 TGTCAAATCCACAAAGTCAGGGG - Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1002890599 6:1328145-1328167 TAGCAAATGCTGCAAGTCAGAGG - Intergenic
1005064093 6:21801552-21801574 AGTGCAATGCTGAAAGTTGGAGG + Intergenic
1005179996 6:23094081-23094103 TGGCCAATTTTGAAAGTTAGTGG - Intergenic
1005379407 6:25218183-25218205 TGTCCCATACTAAAAGTCAATGG + Intergenic
1005535692 6:26754161-26754183 TGTCCTGTGCTGTAAGTCACAGG + Intergenic
1007108490 6:39299365-39299387 TGTGCAAAGCTTAAAATCAGGGG + Exonic
1007356003 6:41318213-41318235 TTTCCAATGGGGAACGTCAGAGG + Intergenic
1007456395 6:41980992-41981014 AGTACAATGCTGAAAGAAAGTGG - Intronic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1009006725 6:57797791-57797813 TGTCCTGTGCTGTAAGTCACAGG + Intergenic
1009008937 6:57820554-57820576 TGTCCTGTGCTGTAAGTCACAGG + Intergenic
1009659294 6:66589749-66589771 TGGCCCATGCTGGAAGGCAGTGG - Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1010873876 6:81076725-81076747 TGTCCAATGCTAAAGTTCACAGG - Intergenic
1011579744 6:88847334-88847356 TGATCGATGCTGAGAGTCAGAGG + Intronic
1012646793 6:101694358-101694380 TGTTCAATGCTGTAAGTTAAAGG + Intronic
1013742147 6:113299830-113299852 TGGCCTATGCTGAAAGTGAAAGG - Intergenic
1014362831 6:120501991-120502013 TTTCCCATGGTGAAAGTCAAAGG + Intergenic
1014638465 6:123878981-123879003 TTTCCAATACTGAAAATGAGTGG + Intronic
1015379259 6:132548052-132548074 TGCTCATTGCTTAAAGTCAGGGG - Intergenic
1015573331 6:134644857-134644879 TGTCCAACCCTGTAAGTCACTGG + Intergenic
1016623441 6:146139389-146139411 TGTCCAATGCTGAAAGTACAGGG + Intronic
1017008945 6:150049342-150049364 TGTTCAAGACTGACAGTCAGAGG + Intergenic
1018968243 6:168505838-168505860 TGCACAATTCTGAAAGTCACTGG - Intronic
1021051103 7:15986114-15986136 TGGCAAATGCTGACAGTCACGGG + Intergenic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1021833362 7:24641206-24641228 CTTCCAATGTTGAAAATCAGTGG - Intronic
1022160375 7:27704489-27704511 TGTCCAATTCAGTAATTCAGTGG + Intergenic
1023462319 7:40412105-40412127 TGTTCAAAGGTGGAAGTCAGAGG + Intronic
1023762189 7:43475588-43475610 TGTCCTAGGCTGAAATGCAGTGG + Intronic
1024530254 7:50385449-50385471 TGTCCGATGCTGACAGCAAGAGG + Intronic
1026546111 7:71323949-71323971 TATCCAACCCAGAAAGTCAGAGG - Intronic
1029907924 7:104111031-104111053 TTTCAAATGCTGACAGTGAGAGG - Intergenic
1031470322 7:122160808-122160830 TTTTAAATGCTGAAAGTCACTGG + Intergenic
1031740690 7:125426326-125426348 TGCCCTAGGCTGTAAGTCAGGGG - Intergenic
1034477197 7:151292254-151292276 TGTCCAATAGTGATGGTCAGTGG - Intergenic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1037209730 8:16371829-16371851 TTTACAGTTCTGAAAGTCAGAGG - Intronic
1037704956 8:21310772-21310794 AGTCCAAGGCTGGGAGTCAGTGG + Intergenic
1037705263 8:21312031-21312053 AGTCCAGGGCTGAGAGTCAGTGG + Intergenic
1039121333 8:34151264-34151286 TGTCACATGCTGAAAGTCACGGG - Intergenic
1039682678 8:39759180-39759202 TGTCCAATACTGAAAGAAAATGG + Intronic
1040512485 8:48107262-48107284 TGTTCAATGCTAGAAGACAGTGG - Intergenic
1041530350 8:58858646-58858668 TGTCAAATGCTGACAGACAGGGG - Intronic
1043367157 8:79546130-79546152 TGTCCAGTGCTGAAAGTAGCTGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044132507 8:88542666-88542688 TGTGCTATCCTGAAAGTCAAAGG - Intergenic
1044511716 8:93088801-93088823 GGACCTATGCTGAAAGGCAGAGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046267919 8:111855988-111856010 TGTCCAATGTTGTAATTAAGGGG - Intergenic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1046500103 8:115065819-115065841 TTTCCAATGCTCAAAGGCATTGG - Intergenic
1047937014 8:129791872-129791894 TGTCCAATACTAAAAGTCGTGGG + Intergenic
1050370030 9:4911442-4911464 TGTACAATGTTGAAAGATAGTGG + Intergenic
1051992322 9:23166410-23166432 TGTCTAATCCTGAAAGTGAGAGG - Intergenic
1052154688 9:25170572-25170594 TGTGCAATTCTGAAAGCCACTGG + Intergenic
1056135429 9:83625372-83625394 TGTCCAAGTCTGAAGTTCAGAGG + Intronic
1057022501 9:91710412-91710434 TGTCCACAGATGGAAGTCAGGGG - Intronic
1057508579 9:95658341-95658363 AGTACAATGCTGAAAAGCAGTGG + Intergenic
1058576623 9:106410475-106410497 TGTCCTATGCTAAAAGTCTTAGG - Intergenic
1058639253 9:107067152-107067174 TCTCCAAAGGTGAAAGGCAGTGG - Intergenic
1062177255 9:135170607-135170629 TGTCCCATGCAGAAAGCCATGGG - Intergenic
1203364940 Un_KI270442v1:248693-248715 TGTCCTTTGCTGAAATTCTGGGG - Intergenic
1189345447 X:40237709-40237731 AGTTCAATGCTGAAAATAAGAGG + Intergenic
1189875767 X:45434241-45434263 TGTCCTGTGCTGAGAGCCAGTGG - Intergenic
1190856560 X:54300933-54300955 TGTCCAAAGCTGAAACTAAAGGG + Intronic
1192940472 X:75906334-75906356 TGTTTAGTGCTGAAAGTGAGAGG + Intergenic
1192945559 X:75963041-75963063 TGTCCAATGGTGGATGTGAGAGG + Intergenic
1195656594 X:107337168-107337190 TTTCCAATTCTAAAAGTCAGTGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1201666241 Y:16459204-16459226 TGACCAATGTTGAAATTTAGAGG - Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic