ID: 1107084060

View in Genome Browser
Species Human (GRCh38)
Location 13:36406584-36406606
Sequence TGGTAGTATCTTGGAGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107084060_1107084066 12 Left 1107084060 13:36406584-36406606 CCAGGTACTCCAAGATACTACCA No data
Right 1107084066 13:36406619-36406641 TTTAAATGTTTAGGGTTTCCTGG No data
1107084060_1107084065 4 Left 1107084060 13:36406584-36406606 CCAGGTACTCCAAGATACTACCA No data
Right 1107084065 13:36406611-36406633 GGTACACTTTTAAATGTTTAGGG No data
1107084060_1107084064 3 Left 1107084060 13:36406584-36406606 CCAGGTACTCCAAGATACTACCA No data
Right 1107084064 13:36406610-36406632 AGGTACACTTTTAAATGTTTAGG No data
1107084060_1107084067 22 Left 1107084060 13:36406584-36406606 CCAGGTACTCCAAGATACTACCA No data
Right 1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107084060 Original CRISPR TGGTAGTATCTTGGAGTACC TGG (reversed) Intergenic
No off target data available for this crispr