ID: 1107084067

View in Genome Browser
Species Human (GRCh38)
Location 13:36406629-36406651
Sequence TAGGGTTTCCTGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107084063_1107084067 2 Left 1107084063 13:36406604-36406626 CCAATCAGGTACACTTTTAAATG No data
Right 1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG No data
1107084062_1107084067 13 Left 1107084062 13:36406593-36406615 CCAAGATACTACCAATCAGGTAC No data
Right 1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG No data
1107084060_1107084067 22 Left 1107084060 13:36406584-36406606 CCAGGTACTCCAAGATACTACCA No data
Right 1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107084067 Original CRISPR TAGGGTTTCCTGGATGCTGC AGG Intergenic
No off target data available for this crispr