ID: 1107084290

View in Genome Browser
Species Human (GRCh38)
Location 13:36409024-36409046
Sequence ATTTTGTTGTTATTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107084290_1107084297 26 Left 1107084290 13:36409024-36409046 CCAGCAGCAAATAACAACAAAAT No data
Right 1107084297 13:36409073-36409095 TATTTTTCTTGGAGTTTCCATGG No data
1107084290_1107084291 -1 Left 1107084290 13:36409024-36409046 CCAGCAGCAAATAACAACAAAAT No data
Right 1107084291 13:36409046-36409068 TCCCTGAAGCCTCCAAATATTGG No data
1107084290_1107084296 15 Left 1107084290 13:36409024-36409046 CCAGCAGCAAATAACAACAAAAT No data
Right 1107084296 13:36409062-36409084 ATATTGGAAACTATTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107084290 Original CRISPR ATTTTGTTGTTATTTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr