ID: 1107088797

View in Genome Browser
Species Human (GRCh38)
Location 13:36453676-36453698
Sequence CTGTGTGGTTAAAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107088797_1107088799 -9 Left 1107088797 13:36453676-36453698 CCTGCTTCCTTTTAACCACACAG No data
Right 1107088799 13:36453690-36453712 ACCACACAGTGTCCTCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107088797 Original CRISPR CTGTGTGGTTAAAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr