ID: 1107088957

View in Genome Browser
Species Human (GRCh38)
Location 13:36455281-36455303
Sequence CAGAACAAGAAGAAAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107088952_1107088957 11 Left 1107088952 13:36455247-36455269 CCAAACAGGAGGGAGGAACTAAA No data
Right 1107088957 13:36455281-36455303 CAGAACAAGAAGAAAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107088957 Original CRISPR CAGAACAAGAAGAAAATGTC AGG Intergenic
No off target data available for this crispr