ID: 1107092106

View in Genome Browser
Species Human (GRCh38)
Location 13:36492962-36492984
Sequence TCACAGCCATGATGTCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107092106_1107092109 18 Left 1107092106 13:36492962-36492984 CCTTAAAGACATCATGGCTGTGA No data
Right 1107092109 13:36493003-36493025 TTCAATGATAATCAGTGTAGGGG No data
1107092106_1107092110 27 Left 1107092106 13:36492962-36492984 CCTTAAAGACATCATGGCTGTGA No data
Right 1107092110 13:36493012-36493034 AATCAGTGTAGGGGATCTCCAGG No data
1107092106_1107092108 17 Left 1107092106 13:36492962-36492984 CCTTAAAGACATCATGGCTGTGA No data
Right 1107092108 13:36493002-36493024 ATTCAATGATAATCAGTGTAGGG No data
1107092106_1107092107 16 Left 1107092106 13:36492962-36492984 CCTTAAAGACATCATGGCTGTGA No data
Right 1107092107 13:36493001-36493023 AATTCAATGATAATCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107092106 Original CRISPR TCACAGCCATGATGTCTTTA AGG (reversed) Intergenic