ID: 1107094507

View in Genome Browser
Species Human (GRCh38)
Location 13:36520380-36520402
Sequence ACACATGCAAATTCTCTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107094507_1107094513 20 Left 1107094507 13:36520380-36520402 CCGTGTAGAGAATTTGCATGTGT No data
Right 1107094513 13:36520423-36520445 CTGGATCAGAAGTTCCCTTGTGG No data
1107094507_1107094510 1 Left 1107094507 13:36520380-36520402 CCGTGTAGAGAATTTGCATGTGT No data
Right 1107094510 13:36520404-36520426 GACATTGCTTTGGATCCCTCTGG No data
1107094507_1107094514 21 Left 1107094507 13:36520380-36520402 CCGTGTAGAGAATTTGCATGTGT No data
Right 1107094514 13:36520424-36520446 TGGATCAGAAGTTCCCTTGTGGG No data
1107094507_1107094509 -9 Left 1107094507 13:36520380-36520402 CCGTGTAGAGAATTTGCATGTGT No data
Right 1107094509 13:36520394-36520416 TGCATGTGTGGACATTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107094507 Original CRISPR ACACATGCAAATTCTCTACA CGG (reversed) Intergenic
No off target data available for this crispr