ID: 1107095769

View in Genome Browser
Species Human (GRCh38)
Location 13:36533441-36533463
Sequence GTAAGCAGGATTCAAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107095769_1107095771 12 Left 1107095769 13:36533441-36533463 CCAGCATTTTGAATCCTGCTTAC No data
Right 1107095771 13:36533476-36533498 ACTCAAGTCCCATCATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107095769 Original CRISPR GTAAGCAGGATTCAAAATGC TGG (reversed) Intergenic
No off target data available for this crispr