ID: 1107095828

View in Genome Browser
Species Human (GRCh38)
Location 13:36534044-36534066
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 3, 1: 9, 2: 39, 3: 76, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107095828 Original CRISPR GGGCAGGTTGCTGCAGATTG TGG Intergenic
901930939 1:12595793-12595815 GGGTAGGTGGCTGCAGAAGGGGG + Intronic
902563647 1:17295508-17295530 GAGCAGGTTGTTGCACAGTGGGG + Intergenic
902794483 1:18792337-18792359 GGGCAGGGTGCTGTGGGTTGCGG - Intergenic
904346524 1:29875596-29875618 GGGCAGGTTGCTGCAGGTTGTGG - Intergenic
905409483 1:37758431-37758453 GAACAGGTTGCAGTAGATTGAGG - Intronic
906030761 1:42718305-42718327 GGGCAGGTGGGGGCACATTGTGG - Intergenic
906953821 1:50356252-50356274 GTGGTGGTTGCTGAAGATTGGGG - Intergenic
907538826 1:55193296-55193318 GGGCAGGTGGATACAGATTTTGG + Intronic
909021990 1:70441658-70441680 GGGCAGCTTGCTGCAGGTTGTGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909139850 1:71849720-71849742 GGGGTGGTTGCTGAAGGTTGGGG - Intronic
909491256 1:76229107-76229129 GGGCGGGTTGCTGCAGGTTGTGG - Intronic
910830626 1:91457574-91457596 GGACAAATTGCTGCAGATTGTGG - Intergenic
911480856 1:98438369-98438391 TGGCAGGGTGCTGGGGATTGTGG - Intergenic
912382705 1:109255858-109255880 GGGCAGGTGGCCACAGATGGTGG + Intronic
913665928 1:121048898-121048920 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
914017326 1:143832174-143832196 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
914655937 1:149740706-149740728 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
917121990 1:171652576-171652598 GTGCACGTTGCTGCAGCTTTGGG - Exonic
919750195 1:201033003-201033025 GTGCAGGGTGCAGCAGAGTGAGG - Intergenic
920547908 1:206833962-206833984 GGGCTGGCTGCTGCAGGGTGTGG + Intronic
920552245 1:206872347-206872369 GGGCTGGTTGTTGCAGATTGTGG - Intergenic
922369833 1:224898220-224898242 GGCCTGATTGCTGCAGGTTGTGG + Intronic
922757840 1:228106311-228106333 GGGCAGGGAGCTGCAGGCTGTGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923211885 1:231810956-231810978 GGGAAAGTTGCTGCACCTTGTGG + Intronic
923481135 1:234385151-234385173 GGGGTGGTTGCTGAAGTTTGGGG + Intergenic
923857801 1:237863669-237863691 GAGCTGGCTGCTGCAGATCGGGG + Intergenic
1063039437 10:2321910-2321932 GTGGTGGTTGCTGAAGATTGTGG + Intergenic
1063558982 10:7108867-7108889 AGGCAGGTTGGGGCAGGTTGAGG + Intergenic
1069065857 10:63941339-63941361 GGGCAGCTGGATGCAGATTGTGG + Intergenic
1070489334 10:76961677-76961699 GGGGTGGTAGCTGAAGATTGTGG - Intronic
1070542376 10:77425474-77425496 GGGCAGGTTTCAACAGAGTGTGG - Intronic
1070587508 10:77777753-77777775 GGACTGGTTACTGCAGACTGTGG - Intergenic
1071213681 10:83373877-83373899 GGGCAGGTTCCTGTAGATGTTGG - Intergenic
1071784125 10:88880281-88880303 GGGACGGTTGCTGCAGGTTCGGG + Exonic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1074363441 10:112840071-112840093 GGCCAGGTTGCTGCAGACTGTGG - Intergenic
1074437577 10:113446988-113447010 TAGGAGGTTGCTGCAGGTTGTGG + Intergenic
1075596174 10:123730895-123730917 GGACTGGTTGCTGCAGGTTGTGG + Intronic
1075710037 10:124525960-124525982 CGGGAGGTGGCTGCAGAGTGAGG + Intronic
1076011174 10:126989917-126989939 GGGCGGGCTGCTGCACACTGTGG - Intronic
1080268906 11:30429678-30429700 TGGCAGGTTGGTGAAGAGTGGGG - Intronic
1081902323 11:46639452-46639474 GGGCTGGTTGCTTCAGGTTGTGG + Intronic
1083678359 11:64340333-64340355 GGGCAGGTGGCAGCGGGTTGGGG + Intronic
1084642325 11:70433288-70433310 GGGCAGGGCGCTGCAGCGTGGGG - Intronic
1087833963 11:102851195-102851217 GGGCAGTTTGCCGCAGGTTGTGG + Intergenic
1087987689 11:104704973-104704995 GTGCTGGTAGCTGCAAATTGTGG - Intergenic
1088123256 11:106394403-106394425 GGGCAGGGTGTTGCAGGATGTGG - Intergenic
1088409743 11:109521009-109521031 GGGCAGATTGCTGCAGGCTGTGG + Intergenic
1088897574 11:114089949-114089971 GGGCAGGAAGCTGCTGATTCTGG + Intronic
1089108201 11:116032772-116032794 GGTGAGGTTGCTGGAGATTAGGG - Intergenic
1089432756 11:118436871-118436893 GCGCAGGTTGGTGCCGATGGCGG - Exonic
1090202722 11:124867745-124867767 CGGGAGGTTCCTGCAGATTTTGG + Intronic
1090544362 11:127746878-127746900 GGGCACATTGGTGCAGAGTGTGG + Intergenic
1092003111 12:5047368-5047390 GAGCTGTTTTCTGCAGATTGTGG + Intergenic
1093512827 12:19949227-19949249 GGGCTGGTTGCTGCAGACTGTGG - Intergenic
1093641065 12:21527601-21527623 GGGCAGGTTGCTCCAGGATAGGG - Intronic
1094001949 12:25705249-25705271 GAGCAGGTTGCTGCAGGTTATGG - Intergenic
1094794597 12:33956543-33956565 GGGCTAGTTACTGCAGATTGAGG - Intergenic
1095535269 12:43238504-43238526 GGGCTGTGTGCTGCAGGTTGTGG + Intergenic
1095724392 12:45435944-45435966 GGGCAGGTTGCTGCAGGCTGAGG - Intronic
1095948280 12:47766341-47766363 GGGCAGGTTGCAGCACTGTGAGG - Intronic
1096217722 12:49807773-49807795 GGGCAGGTTGCTGCAGGCAGTGG - Intronic
1097123453 12:56753844-56753866 CAGCAGGTTGCTGTAGATTGTGG + Intronic
1097573795 12:61365211-61365233 GAGCTGGTTGCTGCAGACTGTGG + Intergenic
1097590074 12:61563634-61563656 AGGCCAATTGCTGCAGATTGTGG - Intergenic
1098805900 12:75020030-75020052 GGGAAGGCTGCAGCAGCTTGTGG + Intergenic
1099132006 12:78844696-78844718 GTGGTGGTTGCTGAAGATTGGGG - Intergenic
1099726935 12:86442846-86442868 GTGGTGGTTGCTGAAGATTGGGG - Intronic
1100468354 12:94869213-94869235 GGGGTGGTTGCTGAAGGTTGGGG - Intergenic
1100814354 12:98371656-98371678 AGGCTGGTTGCTGCAGATTGTGG + Intergenic
1100927073 12:99560791-99560813 GTGGTGGTTGCTGAAGATTGGGG + Intronic
1101119461 12:101564197-101564219 GGGCAGGTGGCAGCAGAATCAGG - Intergenic
1101269809 12:103131715-103131737 TGGCAGGTTGCTCCTGATAGTGG + Intergenic
1101974278 12:109341906-109341928 GGGTAGGCTGCTGCAGGCTGTGG + Intergenic
1101978577 12:109384833-109384855 AGTCAGGTTGCTGCAGGTGGAGG - Intronic
1102194634 12:111016291-111016313 GAGCAGGTTGCAGCATCTTGGGG - Intergenic
1103134956 12:118499281-118499303 GGGAAGGATGCTGCTGATTTGGG - Intergenic
1103751640 12:123168039-123168061 GGTCACGTTGCTGAAGCTTGAGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1106105891 13:26733313-26733335 AGGCTGGTTTCTGCACATTGTGG - Intergenic
1106418600 13:29567209-29567231 GGGCAGGTTGCAGCATTTTTTGG + Intronic
1106871720 13:34029140-34029162 GAGCAGCTTGCTGCAGCTTGTGG - Intergenic
1106928479 13:34637717-34637739 GGGCTAGTTGCTGCATATTATGG + Intergenic
1107021694 13:35758930-35758952 GGGCATGTTGCTGCAGGTTGTGG - Intergenic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107749205 13:43546242-43546264 GGGCAGATTTCAGCAGATTTAGG + Intronic
1107778640 13:43875534-43875556 GGGTTGCTTGCTGCAGGTTGTGG - Intronic
1107892596 13:44927346-44927368 GGGCAGGTTGCTGCAGGTTGCGG + Intergenic
1108212463 13:48152138-48152160 GGGCAGGTGACAGCAGACTGAGG + Intergenic
1108349846 13:49581899-49581921 GGCCAGGTTGCAGCAGGTTGAGG + Intronic
1108440520 13:50448514-50448536 AGGCAGGTTGCTGCAGGCTGTGG - Intronic
1109350610 13:61175868-61175890 TGACAAGTTGCTGAAGATTGGGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112161557 13:96873693-96873715 GAGTAGGGTGCTGCAGATTGTGG - Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112610970 13:100954291-100954313 GGGCTGGTGGCTGCATATGGCGG - Intergenic
1113629849 13:111874705-111874727 GGGAAGGTTGCTGCAGGTCGTGG + Intergenic
1114201508 14:20525354-20525376 CTGCAGGTTGCTGCAGATTTCGG - Intergenic
1116146079 14:41070734-41070756 GAGATAGTTGCTGCAGATTGTGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116862919 14:50008671-50008693 GGGGAGGTTGCTGCAGTGGGAGG + Intergenic
1118960040 14:70521339-70521361 GTGGTGGTTGCTGAAGATTGGGG - Intergenic
1120287213 14:82519105-82519127 AAGTTGGTTGCTGCAGATTGTGG + Intergenic
1121114027 14:91331135-91331157 CGGCAGGTGGCTCCAGACTGGGG + Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1121526678 14:94624181-94624203 GGGCAGGCTGCTGCAGCTGAAGG - Intronic
1121712705 14:96051414-96051436 GAGCAGGTTGCTCCAGCCTGAGG + Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1126477414 15:49079927-49079949 GCGCAGGTTGCTGCACCGTGTGG + Intergenic
1128629121 15:69245484-69245506 GTGGTGGTTGCTGAAGATTGTGG + Intronic
1128668573 15:69557167-69557189 GGGCATTTTGCTTCAGATGGGGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130688965 15:86063881-86063903 GGGTAGGTTGCTGGAGGGTGGGG + Intergenic
1130814641 15:87418405-87418427 GGACAGGTTGCTGCAGGTTGTGG + Intergenic
1132015063 15:98308089-98308111 AGGCAGGTGGCTACAGGTTGTGG + Intergenic
1132703024 16:1230001-1230023 GGGCTGGGGGCTACAGATTGTGG + Intronic
1132705299 16:1240867-1240889 GGGCTGGGGGCTACAGATTGTGG - Intronic
1132708427 16:1256230-1256252 GGGCTGGGGGCTACAGATTGTGG - Exonic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1135908151 16:26532907-26532929 GGTTAGGTTGCTGCTGCTTGAGG + Intergenic
1135995288 16:27243486-27243508 GGGCAGGTTGATGTAGATTTTGG - Intronic
1136082306 16:27860205-27860227 GGGCAGGCAGGTGCAGACTGGGG - Intronic
1136540472 16:30925298-30925320 GGGCAGTTTACCCCAGATTGAGG + Intronic
1136607468 16:31346140-31346162 GGGCTGGTTGCTGCAGGCTGGGG - Intergenic
1137361108 16:47816151-47816173 GGGCAGGTTCCTGGGGCTTGGGG + Intergenic
1138453419 16:57106921-57106943 GGGGAGATTGCTGAACATTGTGG - Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1141228102 16:82138548-82138570 GGGCAGGTTGCTGCAGGTGACGG - Intergenic
1141619137 16:85227596-85227618 GGGGAGGTTCTTGCAGGTTGGGG + Intergenic
1142747854 17:1968945-1968967 GGGCTGGTTGCTGCAGACCATGG - Intronic
1142855300 17:2725859-2725881 GAGAAGGATGCTGCAGATGGAGG + Intergenic
1143351725 17:6293054-6293076 TGGGAGGTACCTGCAGATTGTGG + Intergenic
1144088668 17:11833757-11833779 AAGCAGGTTGCTTCAGATTATGG + Intronic
1144175864 17:12706951-12706973 AAGGAGGTAGCTGCAGATTGGGG - Intronic
1144221369 17:13102773-13102795 GGGTAGGTTGCTGCAGGTTGTGG + Intergenic
1144949310 17:18985461-18985483 GGGCAGGTTGGTGCAGAGCTGGG + Intronic
1145285642 17:21504140-21504162 GGGCTGGTTGCTGCAGATTATGG + Intergenic
1145391882 17:22461559-22461581 GGGCTGGTTGCTGCAGATTATGG - Intergenic
1145912592 17:28551257-28551279 GGGCAGGTTGCTGGTGAATGTGG + Intronic
1145996215 17:29106413-29106435 GGAGAGGATGCTGCAGAATGGGG - Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147049920 17:37786403-37786425 GTGGTGGTTGCTGAAGATTGAGG - Intergenic
1148050020 17:44765291-44765313 GGCCAGGTGGCTGCAGAGTGGGG - Intronic
1151483855 17:74386505-74386527 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
1151570327 17:74922651-74922673 TGGGGGGTTGCTGCAGAGTGAGG - Intronic
1152194127 17:78906522-78906544 GTGGTGGTTGCTGAAGATTGGGG + Intronic
1152800321 17:82327906-82327928 GGGCCGCTGGCTGCAGGTTGTGG - Intronic
1153833526 18:8944060-8944082 GAGCTGGTCACTGCAGATTGTGG - Intergenic
1153986669 18:10357087-10357109 GGGCTGGTTACTGTAGATGGTGG - Intergenic
1153986680 18:10357155-10357177 GGGCTGGTTACTGTAGATGGTGG - Intergenic
1154029938 18:10744859-10744881 TGTCAGGTTCCTGCAGATTTGGG - Intronic
1154128270 18:11713562-11713584 AGGCCAGTTGCTGCAGGTTGTGG + Intronic
1155615221 18:27714401-27714423 GGGCAGATTGCTGCTGGTTGTGG - Intergenic
1157016047 18:43714785-43714807 GGGCTGGTTGCTGGAGTTTGAGG + Intergenic
1157621847 18:49021363-49021385 GGGCTGCGTGCTGCAGATGGAGG - Intergenic
1157885407 18:51361635-51361657 GAGCAGATTGCTGCAGGCTGTGG - Intergenic
1158306983 18:56116702-56116724 GGAGAGCTTGCTCCAGATTGTGG - Intergenic
1158455102 18:57599273-57599295 GGGGAGGTTGTTGCACAGTGAGG - Intergenic
1158499595 18:57988211-57988233 GGGCAGGTTGCTGCCGATCGTGG + Intergenic
1158616847 18:58995772-58995794 GGGAAGGTTGCTCCAGACAGAGG + Intergenic
1158789131 18:60754499-60754521 GGACTGGTTGTTGCACATTGTGG - Intergenic
1159017365 18:63112262-63112284 GGGCTGGCTGCTGTAGACTGTGG - Intergenic
1159611249 18:70527767-70527789 GGGCTGGCTGCTGCAGATTGTGG + Intergenic
1160583402 18:79900192-79900214 GGGCAGGTCCCTGCAGAAGGAGG + Intergenic
1160622195 18:80179375-80179397 GGGCATGTTGCTGCAGTCTAGGG - Intronic
1160681178 19:412319-412341 GACCAGGATGCTGCAGATTCGGG + Intergenic
1162091568 19:8283683-8283705 GGGCATGTAGATGCAGACTGGGG - Intronic
1162093805 19:8298532-8298554 GGGCATGTAGATGCAGACTGGGG - Intronic
1162481075 19:10927541-10927563 GGGCAGGGTGCTGGTGATGGTGG - Intronic
1162844038 19:13378519-13378541 GGGGTGGTTGCTGAAGATTGGGG - Intronic
1166816068 19:45546989-45547011 TGGCACGTGGCTGTAGATTGAGG + Intronic
1166956972 19:46471265-46471287 GGGCCTTTTGCTGCAGATTCAGG - Intronic
1167718823 19:51163236-51163258 GGGCAGGTAGTTGGAGACTGAGG + Intergenic
1167760866 19:51448087-51448109 GGGCAGCTTGATGCTGATGGTGG + Intergenic
924986332 2:273428-273450 TGGCAGGAGTCTGCAGATTGGGG + Intronic
925451566 2:3973598-3973620 GGGCTGGCTGCTGCAGGTTGTGG + Intergenic
925897968 2:8487851-8487873 GGGCTGGTGGCTGCAGCTCGTGG - Intergenic
926075837 2:9942078-9942100 TGGGAGGATGCTGCATATTGTGG - Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
929193090 2:39157868-39157890 GGGGAGGGAGGTGCAGATTGTGG + Intergenic
929419900 2:41779836-41779858 GGGAAAGTTGCTGCAGATCTGGG - Intergenic
929450395 2:42033117-42033139 GAGCTGGATGCTGCAGACTGGGG + Intergenic
931050887 2:58413308-58413330 GTGGTGGTTGCTGAAGATTGGGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932320785 2:70820668-70820690 GGGCGGGTTTCTGCAGAGTCAGG - Intergenic
933993421 2:87649981-87650003 GGGATGATTGCTACAGATTGTGG + Intergenic
934542797 2:95189978-95190000 GGGCAGCTTGCTACAGGTAGAGG - Intergenic
934625153 2:95841703-95841725 GTGGTGGTTGCTGCAGATTGAGG - Intronic
934659345 2:96134869-96134891 GAGAAGGTTGCTGGGGATTGGGG - Intronic
934729683 2:96648734-96648756 GGGCTGGTTGCTGCAGATGGTGG + Intergenic
934808412 2:97259568-97259590 GTGGTGGTTGCTGCAGATTGAGG + Intronic
934829097 2:97497618-97497640 GTGGTGGTTGCTGCAGATTGAGG - Intronic
935125154 2:100216294-100216316 GGGCAGCATGCTGCAGAGAGAGG - Intergenic
935199679 2:100845365-100845387 GTACAGGTTGCTGCAGGCTGGGG + Intronic
935330412 2:101973555-101973577 GGGCTGGTTGCTGCAGATCATGG - Intergenic
935444498 2:103141831-103141853 GGGCAGATTGCTGCAGATTATGG - Intergenic
936088371 2:109485054-109485076 GTGCAGGGTTCTGCAGATTGAGG + Intronic
936300438 2:111300902-111300924 GGGCTGATTGCTACAGATTGCGG - Intergenic
936455584 2:112671262-112671284 GGCCAGCTAGCTGGAGATTGTGG + Intergenic
936488199 2:112945669-112945691 GAGCTGATTTCTGCAGATTGTGG - Intergenic
936547044 2:113401112-113401134 GTGGTGGTTGCTGCAGATTGAGG + Intergenic
937066451 2:119021421-119021443 GGGCAAGTTGTTGCACATTAGGG + Intergenic
938058930 2:128237348-128237370 GGCCTGGTTGCTGCAGATTGCGG - Intronic
938694702 2:133824749-133824771 GTGCTGGTTGCTGCAGGTTGGGG - Intergenic
939036613 2:137139209-137139231 GGACATGTTACTGCTGATTGAGG + Intronic
939042602 2:137208661-137208683 GGGCAGGGTGCTAGAGAATGGGG + Intronic
939624096 2:144455340-144455362 GTGCAGGTTGGTGGAAATTGAGG - Intronic
940367484 2:152864118-152864140 GGGCTGGTTGCTGCAATTTGTGG + Intergenic
941908167 2:170737102-170737124 AGGTTGGTTGCTGCAGATTGTGG - Intergenic
943694952 2:190916991-190917013 GTGGTGGTTGCTGAAGATTGCGG + Intronic
943836213 2:192516883-192516905 GGACTGTTTGCTACAGATTGTGG + Intergenic
945446503 2:209943987-209944009 GAGCAGGTTGTTGCAGGTTGTGG + Intronic
948580404 2:238983929-238983951 GGACAGGTTGCTGGAGATGGTGG + Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1175696221 20:61105225-61105247 GGGCAGCAGGCTACAGATTGGGG + Intergenic
1175967680 20:62667732-62667754 GGGCAGGAGGCTGCAGAGGGGGG - Exonic
1176295252 21:5068746-5068768 GGGCTGGGTGCTGCAGATGTGGG - Intergenic
1176946178 21:14984767-14984789 GGGGAGGTTGCTGAAGGTTGGGG - Intronic
1177580955 21:23021532-23021554 GGGCTGGGTGCTGCAGAGTCTGG - Intergenic
1178704020 21:34858146-34858168 GGGAAAGTTGATGCAGCTTGGGG + Intronic
1179033758 21:37742331-37742353 GGGCAGGTGGCTGCAGGCTGTGG + Intronic
1179861797 21:44193382-44193404 GGGCTGGGTGCTGCAGATGTGGG + Intergenic
1182462350 22:30491719-30491741 TGGCAGTTTGCTTCAGATGGTGG - Exonic
1182467316 22:30525496-30525518 TGGCAGTTTGCTTCAGATGGTGG - Exonic
1182739044 22:32553631-32553653 GGTTAGGTTGCTGGAGATTAGGG + Intronic
1184678347 22:46055347-46055369 GGACAGGTTGCTCCAGCCTGCGG + Intronic
949236410 3:1814445-1814467 GGGCTGCTTGCTGCAGGTTGTGG - Intergenic
949391858 3:3571431-3571453 GTGGAGGTTGCTGGAGGTTGGGG - Intergenic
949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG + Intergenic
950329175 3:12142816-12142838 TGTCAGGTTACTGTAGATTGAGG - Intronic
950494397 3:13325042-13325064 AGGCAGTTTGGTGCAGGTTGAGG - Intronic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
951277152 3:20701870-20701892 TGGCATGTGGCTACAGATTGTGG + Intergenic
951453877 3:22869004-22869026 GGCCTGGTTGCTGCAGGGTGGGG + Intergenic
952616205 3:35276805-35276827 GTGGTGGTTGCAGCAGATTGAGG - Intergenic
952920046 3:38277789-38277811 GGGCAGGGGACTCCAGATTGAGG - Exonic
955774659 3:62420518-62420540 GGGAAGATGGCAGCAGATTGGGG + Intronic
956170185 3:66427146-66427168 GGGCAGAGTGCTGCAGGGTGTGG - Intronic
956237057 3:67084025-67084047 GGACTGGCTGCTGCAGACTGTGG + Intergenic
956697895 3:71934204-71934226 GGGCTGGTTGCTTCAGGTTGTGG - Intergenic
957233646 3:77555026-77555048 GTGGTGGTTGCTGAAGATTGGGG - Intronic
957350331 3:79016726-79016748 GGGCAGATTACTGAAGATAGGGG - Intronic
957574089 3:81986635-81986657 GGGAAGGCTGCAGCAGCTTGTGG - Intergenic
958182708 3:90081648-90081670 TGGCAGGTGGCTGGAGATTCTGG - Intergenic
959291604 3:104481816-104481838 GTGGTGGTTGCTGAAGATTGGGG - Intergenic
959541877 3:107549402-107549424 GGGGAGGTTGCTCTAGAGTGTGG + Intronic
959600835 3:108183341-108183363 GGTCTGGCTGCTGCAGATTGTGG - Intronic
960145098 3:114192373-114192395 GGGTAGCTTGCTGTAGATTGTGG + Intronic
961328306 3:126124554-126124576 GGGAGAGTAGCTGCAGATTGTGG + Intronic
961413139 3:126737729-126737751 AGGAAGGATGCTGCAGATAGGGG + Intronic
961471920 3:127120493-127120515 GGGCTGCTTGCTGGAGAATGTGG + Intergenic
961471927 3:127120558-127120580 TGGCTGGTTGCTGCAGATTGTGG + Intergenic
961480233 3:127174830-127174852 GGGCAGGCTGCAGCAGTTAGAGG - Intergenic
961869390 3:129976817-129976839 GGCCAGGGTGCTGCCGTTTGTGG - Exonic
962409198 3:135126624-135126646 GGCCAGGAAGGTGCAGATTGGGG + Intronic
962488457 3:135867231-135867253 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
962532702 3:136298161-136298183 GGGCAAGTTGCAGCAGAGTGTGG + Intronic
962734007 3:138307954-138307976 GGCCAGATTGCTGCAGGTCGGGG + Intronic
964314057 3:155424687-155424709 GGGCTGTTGGCTGCAGGTTGTGG - Intronic
965965111 3:174479546-174479568 GGGCAGGCGGGTGCAGGTTGGGG + Intronic
967077346 3:186015535-186015557 GTGGTGGTTGCTGCAGGTTGAGG + Intergenic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
967544913 3:190714133-190714155 GTGCTGGTTGCTGAAGGTTGGGG + Intergenic
967648695 3:191958792-191958814 GGGTTGGTTGCTGCAGTTTGTGG - Intergenic
969262921 4:6044999-6045021 GGGCAGCATGCTGCAGGGTGGGG + Intronic
969557728 4:7924701-7924723 GGGCGGGCAGCTGCAGGTTGTGG - Intronic
969700483 4:8765073-8765095 GACCAGGTGGCTGTAGATTGGGG - Intergenic
970208228 4:13678408-13678430 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
970246768 4:14072317-14072339 GGGCTGGTTGCTGCAGTTGGTGG - Intergenic
970930166 4:21501814-21501836 AAGGAGGTTGCTGCAGATTCTGG - Intronic
971276687 4:25205168-25205190 GGGTTGGTTACTACAGATTGTGG - Intronic
972401944 4:38713021-38713043 GGGCTAGTTGCTGCAGATTGTGG + Intergenic
972429790 4:38969817-38969839 GGGCAGGTTGCTGGAGCTCAGGG - Intronic
974036047 4:56819435-56819457 GGACAGGATGCTGCAGGTTGTGG - Intronic
974156240 4:58077095-58077117 GGTCAGGTTACTGAAGAGTGAGG + Intergenic
975623047 4:76313700-76313722 AGGCAGATTCCAGCAGATTGAGG - Intronic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
977672801 4:99715547-99715569 GGGCAGGTTTCTACAAGTTGTGG + Intergenic
979263207 4:118671767-118671789 GGGCAGGTTCTTGTAGACTGCGG + Intergenic
980617431 4:135249062-135249084 GGGCAGCTTGCTACTGATTTAGG - Intergenic
981246365 4:142544429-142544451 GAGCTGGTTGCTGCAGCTGGAGG + Intronic
981340879 4:143620030-143620052 GGACTAATTGCTGCAGATTGTGG - Intronic
981645172 4:146991075-146991097 GGGTGGGTTGCTGGAGAGTGCGG + Intergenic
983203631 4:164888552-164888574 GGGCTGGTTGCTGCAGTTTGTGG + Intronic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
984705448 4:182844339-182844361 TTGCAGGTTGCTGCAGGCTGTGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986461358 5:7975744-7975766 GGGCTGGTTGATGCAGATCCTGG - Intergenic
986646394 5:9920700-9920722 GGACTGGTTGCTGCAGGCTGCGG + Intergenic
986661293 5:10062582-10062604 GGGCTGGTTGCTGCAGTTGTGGG - Intergenic
986694560 5:10340136-10340158 GGACTGGCTGCTGCAGATTGTGG + Intergenic
986904380 5:12476167-12476189 GGGCAGCTTGCTGAAGGTTGTGG + Intergenic
988560297 5:32274796-32274818 CGGCTGGGTGCTGCAGATGGAGG - Intronic
990715336 5:58629973-58629995 GGGAAGGTTGCTGCAGGTTGTGG + Intronic
990832790 5:59978802-59978824 GTGGTGGTTGCTGAAGATTGGGG - Intronic
991731832 5:69597159-69597181 GGGCCAGTTGATGCAGAGTGGGG + Intergenic
991808264 5:70452297-70452319 GGGCCAGTTGATGCAGAGTGGGG + Intergenic
991863120 5:71030708-71030730 GGGCCAGTTGATGCAGAGTGGGG - Intergenic
992226520 5:74624305-74624327 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
992758743 5:79933267-79933289 GGGGAGGTTGCTGCAGGTTGGGG - Intergenic
992939259 5:81747209-81747231 GGGTAGGATGCTACAGATTTAGG - Intronic
994454720 5:99990409-99990431 GGATTGGTTGCTGCAGATTCTGG - Intergenic
996670888 5:126115520-126115542 GGGCTGGTTGCTGCAGGTTGTGG + Intergenic
996810142 5:127507387-127507409 GGACTGGTTGCTACAGGTTGTGG - Intergenic
997810056 5:136958228-136958250 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
999531165 5:152464924-152464946 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
999927539 5:156395535-156395557 GGGAAGGTTGCTGCATTTTGTGG + Intronic
1000186347 5:158862178-158862200 TGGCAGATTGCTGGAGATGGAGG + Intronic
1001190529 5:169626517-169626539 GTGGTGGTTGCTGAAGATTGGGG - Intergenic
1001252180 5:170154851-170154873 GGGCAGGTTGCTGAGGACAGAGG - Intergenic
1002830017 6:811854-811876 GTCCAGGTTGCTACAGATTTAGG - Intergenic
1003461620 6:6334067-6334089 GGGCAGGTTGCTGCAGGCTGTGG + Intergenic
1004039349 6:11960543-11960565 GGGCTGGTTGCTGCAGGTTGAGG - Intergenic
1004087477 6:12464903-12464925 AGGCAGGTTGCTGCTTATGGGGG - Intergenic
1004174671 6:13329022-13329044 GGGCAGGTTGCTGCAGGTTGTGG + Intergenic
1004188525 6:13443851-13443873 GTGCTGGTTGCTGAAGGTTGGGG - Intronic
1004232928 6:13849350-13849372 GGGCAGGCTGCTGCAGGCTGTGG + Intergenic
1004302386 6:14470232-14470254 GGGCAGATTCCTGCAGATTGTGG - Intergenic
1005692991 6:28325160-28325182 GGGCAGCTTGCTGCTTACTGGGG - Exonic
1005914041 6:30336516-30336538 GTGGTGGTTGCTGAAGATTGGGG + Intronic
1006392389 6:33766155-33766177 GGGCATGGTGCTGCAGCTGGGGG - Intergenic
1006809979 6:36813757-36813779 GGGCAGGGTGTTGCAGGTGGAGG - Intronic
1007431702 6:41780609-41780631 GGGCCTGGAGCTGCAGATTGGGG - Intronic
1008196897 6:48535661-48535683 GAACCGGTTGCTGCAGATTGTGG - Intergenic
1009607302 6:65888446-65888468 GGGCTAATTGCTGCAGGTTGTGG + Intergenic
1010864449 6:80957133-80957155 GGACTGGTGGCTGCAGATTGTGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1011247327 6:85333140-85333162 AGACTGGTTGCTACAGATTGTGG + Intergenic
1011558906 6:88595667-88595689 GGGCCGGTGGCTGCAGATGTGGG - Intergenic
1013282760 6:108654139-108654161 GGGCAGGATGCTGCAGGGAGTGG + Intronic
1013462632 6:110389910-110389932 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1013615150 6:111835940-111835962 GGACAGGTTTCTGCAGGTGGTGG + Intronic
1014116618 6:117674739-117674761 GGGCAGTTTGCTTCAAATAGTGG + Intergenic
1014466236 6:121760346-121760368 GGGCAAGCTGAAGCAGATTGGGG + Intergenic
1015208286 6:130666899-130666921 GGGCACATTGCTGCAGCTTTTGG - Intergenic
1015518007 6:134103283-134103305 GGGCACATTGCTGCAGGTTGTGG + Intergenic
1016797955 6:148137947-148137969 GGGCTGGTTGCTGCAGACTGTGG + Intergenic
1017191200 6:151654583-151654605 GGGGTGGTGGCTGCAGCTTGGGG + Intergenic
1017349930 6:153427971-153427993 GGACTGGTTGCTGCAGATTATGG + Intergenic
1017557224 6:155584160-155584182 GGGCAGGTTGCTGCAGGGGTGGG + Intergenic
1018419034 6:163626152-163626174 GGGCAGGATGCTGCAGGAAGTGG + Intergenic
1018818448 6:167353946-167353968 GTGGAGGTTGCTGAAGGTTGGGG - Intronic
1019435677 7:1021014-1021036 GGGCAGGTACCTCCAGGTTGGGG + Intronic
1019735553 7:2648314-2648336 GGGCAGGTTGCTTCAGGTCCTGG - Intronic
1019781733 7:2944415-2944437 GGCCAGGTTGCGGCAGCTGGAGG - Exonic
1020101014 7:5394474-5394496 GGGCAGGTTGCTAGGGGTTGGGG + Exonic
1020806449 7:12795695-12795717 GGTCAGGTTTCTGCTGATGGAGG - Intergenic
1021219100 7:17954090-17954112 TAGCAGGTTGCTGAAGGTTGGGG - Intergenic
1022891509 7:34704926-34704948 GAGCTGGTTGCTGCAGGTTGTGG + Intronic
1023004981 7:35854591-35854613 GCACAGGTTGCTGCAGATGCTGG - Intronic
1023992326 7:45135671-45135693 CGGCTGGTTGCTGCAGACTATGG + Intergenic
1024168906 7:46764239-46764261 GGGCAGTTTGCCACAGATTGTGG - Intergenic
1024589273 7:50867153-50867175 GGGCAGGTTGCTGGGGGATGTGG + Intergenic
1025858803 7:65307390-65307412 GGGCAGGGTTCTGCAGAATCTGG + Intergenic
1025974617 7:66359765-66359787 GGGGAGGTTCCTGCAGATCAGGG - Intronic
1029287474 7:99475761-99475783 GAGCTGGTTGCTGCAGGGTGTGG + Intronic
1030111692 7:106032214-106032236 GGGCAGGCTGGTGGAGATTGTGG + Intronic
1030319081 7:108145530-108145552 GGGCAGGTAGGTGGAGACTGGGG + Intergenic
1031670460 7:124536811-124536833 GTGGTGGTTGCTGAAGATTGGGG + Intergenic
1031795584 7:126170269-126170291 GGGCTGGTTGCTGCAGATTGCGG + Intergenic
1034219729 7:149434440-149434462 GAGCAGGCAGCTGCAGAGTGTGG + Intronic
1035309628 7:157957226-157957248 GTACAGGGTGCTGCAGATTCTGG - Intronic
1036155145 8:6334850-6334872 GGGTAGGTTGCTGCAAATAAGGG - Intergenic
1036610631 8:10346881-10346903 GGGCTGGTTGCTGCAGGTTGTGG + Intronic
1037191882 8:16136266-16136288 GTGATGGTTGCTGAAGATTGAGG - Intronic
1037901467 8:22691798-22691820 GGGCAGGTAGCTGCAGCTACAGG + Intronic
1038501127 8:28044758-28044780 GGGCAGGTGGCTGCAGGTTGTGG + Intronic
1040960993 8:53032594-53032616 CTGGAGGTTGCTGCAGATTGTGG + Intergenic
1041009361 8:53526523-53526545 GTGGTGGTTGCTGAAGATTGTGG - Intergenic
1041131170 8:54702598-54702620 GTGGTGGTTGCTGCAGATTGGGG + Intergenic
1041146553 8:54881952-54881974 GGGTTGGTTGCTGCAGAGTTTGG + Intergenic
1041183368 8:55271933-55271955 TGGCAAGATGCTACAGATTGTGG + Intronic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1041926191 8:63239140-63239162 GTGATGGTTGCTGAAGATTGGGG + Intergenic
1043099182 8:76018280-76018302 GTGCTGCTTGCTGAAGATTGAGG - Intergenic
1045533781 8:103008215-103008237 GGGAAGGTAGCTGCAGCGTGTGG + Intergenic
1047279748 8:123434785-123434807 GAGAAGGTTGCTGCAGATGGAGG + Intronic
1047301758 8:123619431-123619453 GGACAGGCTGCTGCAGGTTTTGG + Intergenic
1049029674 8:140024970-140024992 AGGCAGGGTGCTGCACAGTGGGG + Intronic
1049278838 8:141733793-141733815 AGGCAGCTTGCTGCAGAGTGAGG - Intergenic
1049469161 8:142767710-142767732 GGGCAGGATGCTGCAGTTCACGG - Intronic
1049576646 8:143392806-143392828 GGCTGGGGTGCTGCAGATTGGGG - Intergenic
1049818693 8:144621108-144621130 GGGCAGGCAGCTGCAGGCTGGGG - Intergenic
1052481868 9:29039756-29039778 GGGCTGGCTGCTGCTGACTGAGG + Intergenic
1053664150 9:40305774-40305796 GAGCAGCCTGCTGCAGAGTGAGG + Intronic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055282780 9:74693821-74693843 TTGGAAGTTGCTGCAGATTGGGG + Intergenic
1055778157 9:79788950-79788972 GGGCAGGTTGCTTCAGGTTGTGG + Intergenic
1056227388 9:84509451-84509473 GTGCTGGTTGCTGAAGGTTGGGG - Intergenic
1056602021 9:88053927-88053949 GGGCAGCTTGCTGCAGACTGTGG - Intergenic
1057561768 9:96133447-96133469 GGTCTGGTTGCTGCAGATGGTGG - Intergenic
1057701068 9:97363420-97363442 GGGTAGGTTGCTGCACATCATGG + Intronic
1059015614 9:110512338-110512360 TGGCAAGTTGAGGCAGATTGAGG + Intronic
1059049725 9:110910783-110910805 GAGGAAGTTGCTGCAGATTTGGG + Intronic
1059049744 9:110911177-110911199 GTGGTGGTTGCTGAAGATTGGGG - Intronic
1059176052 9:112171037-112171059 GGAATGATTGCTGCAGATTGTGG - Intronic
1059392057 9:114005557-114005579 GGGCAGGTGGCGGCAGATGGCGG + Intronic
1059681633 9:116591322-116591344 GGGCAGGTGGCTTCAGGTTCCGG - Intronic
1061590886 9:131596820-131596842 GGGCCGCTTGCTGCAGTTTTGGG - Intronic
1061718426 9:132536359-132536381 GGCCTAGCTGCTGCAGATTGTGG + Intronic
1061752675 9:132791743-132791765 GGGCAGGTTGCTGCAGGTTGTGG - Intronic
1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG + Intronic
1062059910 9:134489702-134489724 GGGTGGGTTGCTGCGGATTGTGG + Intergenic
1187448600 X:19378054-19378076 GTGCAGGTTTCTGCCGGTTGAGG - Intronic
1189829985 X:44962886-44962908 GTGGTGGTTGCTGCAGGTTGGGG + Intronic
1190279164 X:48918279-48918301 GGGCAGGGGGCTTCAGATTCCGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1194001700 X:88437737-88437759 GGACTGGTTGCTGCAGATAGTGG - Intergenic
1194244968 X:91499977-91499999 GTGCAGGCTGCAGCAGAGTGTGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196029450 X:111080296-111080318 GTGGTGGTTGCTGTAGATTGGGG - Intronic
1197893710 X:131289259-131289281 GGGCAGTTTGCTGCATCTGGAGG - Exonic
1199289842 X:146093495-146093517 GGGCACGTTGCTGCAAGTGGTGG + Intergenic
1200563943 Y:4741287-4741309 GTGCAGGCTGCAGCAGAGTGTGG + Intergenic
1202115341 Y:21466053-21466075 GGGCAGGTGGTTGCAGCTTAGGG + Intergenic