ID: 1107097081

View in Genome Browser
Species Human (GRCh38)
Location 13:36548511-36548533
Sequence ACCGGACACATGGAGTAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107097081_1107097084 5 Left 1107097081 13:36548511-36548533 CCGCATTACTCCATGTGTCCGGT No data
Right 1107097084 13:36548539-36548561 TACTTCTCCTCCCCCATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107097081 Original CRISPR ACCGGACACATGGAGTAATG CGG (reversed) Intergenic
No off target data available for this crispr