ID: 1107100106 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:36581128-36581150 |
| Sequence | CAGAATGAGGAGATGTGGTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107100106_1107100110 | 3 | Left | 1107100106 | 13:36581128-36581150 | CCAAACCACATCTCCTCATTCTG | No data | ||
| Right | 1107100110 | 13:36581154-36581176 | TTAGGCTGTTGAGCTTTTAAAGG | No data | ||||
| 1107100106_1107100111 | 26 | Left | 1107100106 | 13:36581128-36581150 | CCAAACCACATCTCCTCATTCTG | No data | ||
| Right | 1107100111 | 13:36581177-36581199 | TAAATACAGAAAAGAATATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107100106 | Original CRISPR | CAGAATGAGGAGATGTGGTT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||