ID: 1107100106

View in Genome Browser
Species Human (GRCh38)
Location 13:36581128-36581150
Sequence CAGAATGAGGAGATGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107100106_1107100110 3 Left 1107100106 13:36581128-36581150 CCAAACCACATCTCCTCATTCTG No data
Right 1107100110 13:36581154-36581176 TTAGGCTGTTGAGCTTTTAAAGG No data
1107100106_1107100111 26 Left 1107100106 13:36581128-36581150 CCAAACCACATCTCCTCATTCTG No data
Right 1107100111 13:36581177-36581199 TAAATACAGAAAAGAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107100106 Original CRISPR CAGAATGAGGAGATGTGGTT TGG (reversed) Intergenic
No off target data available for this crispr