ID: 1107101925

View in Genome Browser
Species Human (GRCh38)
Location 13:36602452-36602474
Sequence CAAGCCAATGCCATAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107101925_1107101928 13 Left 1107101925 13:36602452-36602474 CCAATCTCTATGGCATTGGCTTG No data
Right 1107101928 13:36602488-36602510 TGATATGACCTCCCAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107101925 Original CRISPR CAAGCCAATGCCATAGAGAT TGG (reversed) Intergenic
No off target data available for this crispr