ID: 1107103145

View in Genome Browser
Species Human (GRCh38)
Location 13:36615624-36615646
Sequence GTTCATCCAATCCCAAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107103145_1107103148 7 Left 1107103145 13:36615624-36615646 CCCTGCTTTGGGATTGGATGAAC No data
Right 1107103148 13:36615654-36615676 AAGCATTTTCTGCATTCTGCTGG 0: 9
1: 109
2: 84
3: 85
4: 361
1107103145_1107103149 13 Left 1107103145 13:36615624-36615646 CCCTGCTTTGGGATTGGATGAAC No data
Right 1107103149 13:36615660-36615682 TTTCTGCATTCTGCTGGTTGTGG 0: 6
1: 106
2: 103
3: 83
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107103145 Original CRISPR GTTCATCCAATCCCAAAGCA GGG (reversed) Intergenic
No off target data available for this crispr