ID: 1107104103

View in Genome Browser
Species Human (GRCh38)
Location 13:36625303-36625325
Sequence AAGCACATGTAGAAGTAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107104102_1107104103 -2 Left 1107104102 13:36625282-36625304 CCACTGGCTCTAAAGTCAGAGAA No data
Right 1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG No data
1107104101_1107104103 7 Left 1107104101 13:36625273-36625295 CCTCACGGTCCACTGGCTCTAAA No data
Right 1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG No data
1107104100_1107104103 8 Left 1107104100 13:36625272-36625294 CCCTCACGGTCCACTGGCTCTAA No data
Right 1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107104103 Original CRISPR AAGCACATGTAGAAGTAGAC AGG Intergenic
No off target data available for this crispr