ID: 1107104198

View in Genome Browser
Species Human (GRCh38)
Location 13:36626009-36626031
Sequence CTGTCTAATGGGCTGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107104190_1107104198 15 Left 1107104190 13:36625971-36625993 CCATTTTCTCATCTGCAGGATGG No data
Right 1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG No data
1107104186_1107104198 27 Left 1107104186 13:36625959-36625981 CCACCTGTGCCTCCATTTTCTCA No data
Right 1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG No data
1107104187_1107104198 24 Left 1107104187 13:36625962-36625984 CCTGTGCCTCCATTTTCTCATCT No data
Right 1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG No data
1107104189_1107104198 18 Left 1107104189 13:36625968-36625990 CCTCCATTTTCTCATCTGCAGGA No data
Right 1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107104198 Original CRISPR CTGTCTAATGGGCTGATGTG AGG Intergenic
No off target data available for this crispr