ID: 1107104647

View in Genome Browser
Species Human (GRCh38)
Location 13:36630301-36630323
Sequence AGGGGTTTGCTCTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107104644_1107104647 -10 Left 1107104644 13:36630288-36630310 CCAGGAAAAGAATAGGGGTTTGC No data
Right 1107104647 13:36630301-36630323 AGGGGTTTGCTCTCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107104647 Original CRISPR AGGGGTTTGCTCTCTGAGGA GGG Intergenic
No off target data available for this crispr