ID: 1107108293

View in Genome Browser
Species Human (GRCh38)
Location 13:36670292-36670314
Sequence CAATGTCACCCTGAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107108284_1107108293 28 Left 1107108284 13:36670241-36670263 CCCTGTTGACTTTGGCAGCTACC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 188
1107108288_1107108293 -1 Left 1107108288 13:36670270-36670292 CCTAAAATCACTAGAGTTTACCC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 188
1107108287_1107108293 6 Left 1107108287 13:36670263-36670285 CCAAAAGCCTAAAATCACTAGAG 0: 1
1: 0
2: 1
3: 17
4: 257
Right 1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 188
1107108285_1107108293 27 Left 1107108285 13:36670242-36670264 CCTGTTGACTTTGGCAGCTACCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 188
1107108286_1107108293 7 Left 1107108286 13:36670262-36670284 CCCAAAAGCCTAAAATCACTAGA 0: 1
1: 0
2: 10
3: 396
4: 14705
Right 1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107108293 Original CRISPR CAATGTCACCCTGAGGAGGT AGG Intergenic
900187097 1:1337666-1337688 CAATCCCACCCAGATGAGGTGGG + Intronic
902803513 1:18846294-18846316 CATTGTCTCCCAGAGGAGGGAGG - Intronic
902979576 1:20113339-20113361 CCCTTTGACCCTGAGGAGGTGGG + Exonic
903958612 1:27042147-27042169 CAAGGTCACCCTGTGGTGGCAGG + Intergenic
904531241 1:31171068-31171090 CTCAGTCACCCAGAGGAGGTGGG - Intergenic
905852196 1:41282751-41282773 CACTGTCACCTTGAGAAGGGCGG - Intergenic
906536504 1:46553721-46553743 CAATGTCTCCCTCTGAAGGTGGG - Intergenic
907043718 1:51286262-51286284 CGATGTCACCCATAGGAGGCTGG + Intergenic
910324874 1:85995566-85995588 CCATGGTACCCTGAGGAGGGAGG + Intronic
914823697 1:151125539-151125561 CAATGACACCCTGAAATGGTCGG - Exonic
915514054 1:156402418-156402440 CACTGTGGCCCTGGGGAGGTGGG - Intergenic
917783545 1:178426792-178426814 GAATGTCAAACTGAGGAGTTTGG + Intronic
918511426 1:185317477-185317499 CAAGGTGATCCTGAGGAGATAGG + Intergenic
919556409 1:199059942-199059964 TAATGTAACCCTTAGGAGCTAGG + Intergenic
920497274 1:206464104-206464126 CCAGGGCGCCCTGAGGAGGTTGG - Exonic
920686853 1:208115956-208115978 AAATGTCACACTGAGGTGTTTGG - Intronic
920962361 1:210674638-210674660 AAATGTCACCCTGTGTAGCTGGG - Exonic
1065958693 10:30715769-30715791 CATTGTCAGGCTGAGGAGGGAGG + Intergenic
1070631334 10:78086836-78086858 AACTGTCACCCTGGAGAGGTAGG - Intergenic
1075216777 10:120543247-120543269 CAATGCCAGCTTGAGGAGGAAGG - Intronic
1075903823 10:126063949-126063971 CACAGTCACCCTGAAGAGGGAGG - Intronic
1077797787 11:5509481-5509503 CACTGTCACCTTGATGAGGTGGG + Exonic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1079931740 11:26572145-26572167 CAATGTCGCACTGAGCAGGAGGG + Intronic
1081909939 11:46694304-46694326 CAGTCTCACCCTGGGGAGCTGGG - Intronic
1081951070 11:47043442-47043464 CACTGTACCCCTAAGGAGGTTGG - Intronic
1083621465 11:64051433-64051455 CAGTGCCACCCTGGGGAGGGTGG - Intronic
1083943928 11:65913406-65913428 CACTGCCAGCCTGAGGGGGTGGG + Intergenic
1090225499 11:125069847-125069869 CATTGTCATCCTGACGAGGAAGG - Intronic
1090335153 11:125957178-125957200 CAAAGTTGCCCCGAGGAGGTGGG + Exonic
1093109277 12:15129795-15129817 CTATGTCACACTAAGGAGCTTGG + Intronic
1094211529 12:27898245-27898267 CACTGTAACTCTGGGGAGGTGGG - Intergenic
1094761783 12:33541458-33541480 AAATGTCATCCTAAGGAGCTTGG + Intergenic
1095754974 12:45754744-45754766 AACTGTGAGCCTGAGGAGGTAGG + Intronic
1096592450 12:52669997-52670019 GAATGTCACCTTCAGCAGGTTGG - Intergenic
1096614428 12:52823810-52823832 CATTGTCACCCCGAGGGGCTAGG - Intronic
1098585377 12:72147386-72147408 CCTTGTCACCCTGGGGAGGCCGG + Intronic
1099276092 12:80578012-80578034 CAACGTCACTCTGAGTACGTAGG - Intronic
1099610124 12:84857510-84857532 AAATGTCACCCCCAGGAGCTAGG + Intergenic
1100530303 12:95456094-95456116 AAAGGTCAAGCTGAGGAGGTAGG + Intergenic
1100805117 12:98275259-98275281 AAAAGTCAGCCTGAGGAGCTGGG + Intergenic
1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG + Intergenic
1110275626 13:73639213-73639235 CCATGACACCCTGACCAGGTAGG - Intergenic
1110614948 13:77531052-77531074 CCATAACACCCTGAGGAGCTGGG + Intergenic
1112343389 13:98570764-98570786 CATAGTCACCCTCAGGAGGCAGG + Intronic
1113446464 13:110371987-110372009 CATTTGCACCCTGAGGAGCTGGG + Intronic
1115467997 14:33737232-33737254 AAAGGTCACGCTGAGGAGGCGGG + Intronic
1116628097 14:47292779-47292801 AAATGACACCTTGAGGAAGTAGG - Intronic
1118256595 14:64210857-64210879 CAATGTCTTCCTGAGAAGGAGGG - Intronic
1118839369 14:69499644-69499666 CAATGTCACACTGGGGTGCTCGG + Intronic
1120759821 14:88275161-88275183 CAATGTGACCCTGATGTTGTGGG - Intronic
1121772063 14:96554539-96554561 TGATGACACCATGAGGAGGTAGG - Intronic
1123472050 15:20562714-20562736 CAAAGTCACCCTGGGGTGATTGG - Intergenic
1123645953 15:22437639-22437661 CAAAGTCACCCTGGGGTGATTGG + Intergenic
1123667262 15:22617493-22617515 CAAAGTCACCCTGGGGTGATTGG + Intergenic
1123732354 15:23157705-23157727 CAAAGTCACCCTGGGGTGATTGG - Intergenic
1123750489 15:23355087-23355109 CAAAGTCACCCTGGGGTGATTGG - Intronic
1124282858 15:28379003-28379025 CAAAGTCACCCTGGGGTGATTGG - Intronic
1124299841 15:28532610-28532632 CAAAGTCACCCTGGGGTGATTGG + Intronic
1124321103 15:28712060-28712082 CAAAGTCACCCTGGGGTGATTGG + Intronic
1124481395 15:30083295-30083317 CAAAGTCACCCTGGGGTGATTGG - Intronic
1124487850 15:30135391-30135413 CAAAGTCACCCTGGGGTGATTGG - Intronic
1124522199 15:30413899-30413921 CAAAGTCACCCTGGGGTGATTGG + Intronic
1124536466 15:30552319-30552341 CAAAGTCACCCTGGGGTGATTGG - Intronic
1124542939 15:30604368-30604390 CAAAGTCACCCTGGGGTGATTGG - Intronic
1124755679 15:32402930-32402952 CAAAGTCACCCTGGGGTGATTGG + Intronic
1124762185 15:32455273-32455295 CAAAGTCACCCTGGGGTGATTGG + Intronic
1124776444 15:32593795-32593817 CAAAGTCACCCTGGGGTGATTGG - Intronic
1127242563 15:57133466-57133488 CAATGGCACCCTGAGGACCTCGG - Intronic
1129474509 15:75775871-75775893 CAAAGTCACCCTGGGGTGGTTGG - Intergenic
1129838273 15:78727456-78727478 CAAAGTCACCCTGGGGTGATTGG - Intronic
1130260310 15:82349077-82349099 CAAAGTCACCCTGGGGTGATTGG + Intronic
1130268420 15:82430356-82430378 CAAAGTCACCCTGGGGTGATTGG - Intronic
1130280923 15:82519930-82519952 CAAAGTCACCCTGGGGTGATTGG - Intergenic
1130472293 15:84236111-84236133 CAAAGTCACCCTGGGGTGATTGG - Intronic
1130479786 15:84350682-84350704 CAAAGTCACCCTGGGGTGATTGG - Intergenic
1130483918 15:84387115-84387137 CAAAGTCACCCTGGGGTGATTGG - Intergenic
1130491984 15:84437447-84437469 CAAAGTCACCCTGGGGTGATTGG + Intergenic
1130503600 15:84516487-84516509 CAAAGTCACCCTGGGGTGATTGG + Intergenic
1130594591 15:85240747-85240769 CAAAGTCACCCTGGGGTGATTGG - Intergenic
1132722568 16:1323964-1323986 CAGTGTGACCCTGAGGATGGGGG - Intronic
1134826615 16:17289636-17289658 AACTGTCACCCTGATGATGTTGG - Intronic
1135380776 16:21994557-21994579 CATGGTCACTCTGAGGAGCTGGG - Intronic
1136093244 16:27935682-27935704 AAATGTCACCTTGAGGAACTTGG - Intronic
1136099069 16:27980079-27980101 CAACTTCAGCCTGAGCAGGTGGG + Intronic
1136575050 16:31118337-31118359 GAATGCCACCCTAAGGAGTTTGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138973310 16:62172129-62172151 CAGTGTCTCCCTAAGAAGGTTGG - Intergenic
1140193365 16:72836940-72836962 AAATGACATCCTGAGAAGGTGGG - Intronic
1142356833 16:89605313-89605335 CAATGTCACCAGGTGGACGTCGG + Intergenic
1142876557 17:2854591-2854613 CAAAGTCACCCTATGGCGGTGGG - Intronic
1144207576 17:12989938-12989960 TAATGTCAGCCTTAGGAGGCAGG - Intronic
1147333418 17:39712309-39712331 CCATAGCACACTGAGGAGGTGGG - Exonic
1147917727 17:43898609-43898631 TAATGCCAGCCTGAGCAGGTGGG + Intronic
1148790360 17:50169242-50169264 CAATGTGACCCTGGTGAGGAGGG + Exonic
1151988868 17:77561330-77561352 CAATGTCACCGGCAGGTGGTTGG - Intergenic
1151988920 17:77561648-77561670 CAATGTCACCGGCAGGTGGTTGG - Intergenic
1151988979 17:77562019-77562041 CAATGTCACCGGCAGGTGGTTGG - Intergenic
1154371340 18:13765658-13765680 CAAAGTCACCCAGAGGAGTGTGG - Intergenic
1155325136 18:24657408-24657430 AAATGACAGCCTGAGGAAGTGGG + Intergenic
1156337620 18:36185262-36185284 GAATGGCACTCTGAGGAGGGAGG - Intergenic
1156699296 18:39806155-39806177 CAATGTCACACATGGGAGGTGGG - Intergenic
1157741138 18:50094340-50094362 CAGTGTAACTCTGAGCAGGTGGG + Intronic
1161240160 19:3218545-3218567 CAGTGTCACCCTGAGCTGGACGG + Intergenic
1161741807 19:6025605-6025627 CTATGACAACCCGAGGAGGTAGG + Intronic
1161884386 19:6982520-6982542 CCATGTCACCCTGATGTGTTGGG - Intergenic
1162318980 19:9959803-9959825 CAAGGTGAGCCTGGGGAGGTGGG + Exonic
1164452659 19:28380339-28380361 CAATGACACCCTGAGGCTGCTGG - Intergenic
1167705684 19:51079659-51079681 CAAGCACAACCTGAGGAGGTGGG - Exonic
1168540632 19:57206846-57206868 AAATGTCACCCTGAGGTTTTTGG - Intronic
1168545918 19:57249755-57249777 AAATGTCACCCTGAGGTTTTTGG - Intronic
1168591871 19:57643029-57643051 AAAGGACACCCTGAGGAAGTGGG + Intergenic
924975731 2:172838-172860 CAATGCCACACTTAGGATGTGGG - Intergenic
926679934 2:15655308-15655330 CAAAGTCAGGTTGAGGAGGTTGG - Intergenic
926706459 2:15841183-15841205 CACTGTCACCCGGAGGCTGTAGG + Intergenic
926728205 2:16014825-16014847 CCATGCCAACCTGAAGAGGTTGG - Intergenic
929028705 2:37630152-37630174 CACTTTCACCATGGGGAGGTGGG - Intergenic
930075255 2:47401151-47401173 CAGAATCACCCTGGGGAGGTGGG - Intergenic
930703510 2:54483023-54483045 AAATGTGACCCTGAGGAGGCCGG + Intronic
931052096 2:58427133-58427155 TAATGTCACCCTTAGAAGTTTGG - Intergenic
931797087 2:65721633-65721655 TTATTTCACCCTGAGGAGGAGGG - Intergenic
932386358 2:71336761-71336783 CAATGTTACCCTGAGCAAGCTGG - Intronic
932503183 2:72202911-72202933 GAAAGTCACACTGAGGAGGGTGG + Intronic
934871206 2:97867765-97867787 CAGTTTCACCCTGAGAAGGGAGG - Intronic
935171622 2:100614794-100614816 CAATGTTACCCAGAGGAGGGCGG + Intergenic
937036332 2:118785729-118785751 CAATGTCACCCTCAGGACTTAGG - Intergenic
937306878 2:120877097-120877119 CAAGGTCATGCTGAGGAGCTGGG - Intronic
937454636 2:122030753-122030775 CCATGTCACCTTGTGGAGGTTGG + Intergenic
942045598 2:172097522-172097544 CACAGTCACCCTCAGGAGGAAGG + Intergenic
943391014 2:187267787-187267809 CAAGGTCACCCAGAGGAGGGGGG + Intergenic
946366798 2:219253693-219253715 CAAAGTCACCAGGAGGGGGTTGG + Intronic
947613519 2:231539122-231539144 GAATTACACACTGAGGAGGTTGG - Intergenic
947764511 2:232628762-232628784 CAATTTCTCCCTGGAGAGGTAGG + Intronic
1174863658 20:54115112-54115134 CAAATTCACCCTCAGGAGATGGG - Intergenic
1175339083 20:58216264-58216286 AAATGTCACCATGAAGAGTTTGG + Intergenic
1175968782 20:62673463-62673485 CAGTGACACCCGGAGGAGGCAGG - Intronic
1178958609 21:37044401-37044423 GAAAGTGACCCTGAGGAGGCAGG - Intergenic
1184669470 22:46005298-46005320 CAATGTCACCATCAGAAGGGTGG - Intergenic
949620791 3:5809618-5809640 CCACCTCACCCTGAGGAGGGAGG + Intergenic
950651689 3:14411185-14411207 CAATGCCAGGCTAAGGAGGTTGG - Intronic
956547279 3:70418623-70418645 CTCTGTCACCCTCAGGAGATGGG + Intergenic
963464239 3:145658449-145658471 AGATGTCACACTGAGGAGATTGG - Intergenic
964144227 3:153439835-153439857 TATTGTCATCCTGAGAAGGTGGG + Intergenic
966219625 3:177537796-177537818 CAGTGTCACTTTGAGGAGGGTGG + Intergenic
969452940 4:7285332-7285354 TAATGTCAACATGAGGAGATGGG - Intronic
969648461 4:8448103-8448125 AAATGCCACCCTGGGAAGGTGGG - Intronic
971013430 4:22463760-22463782 CAAAAGCATCCTGAGGAGGTTGG + Intronic
971415636 4:26425778-26425800 CAAGGTCAGACTGAAGAGGTTGG + Intronic
972378640 4:38498214-38498236 TAATGCCACTCTGAGAAGGTGGG + Intergenic
974777967 4:66511666-66511688 GTAAGTCATCCTGAGGAGGTGGG - Intergenic
975991411 4:80263449-80263471 AAAAGTGACCCTGAGGGGGTTGG + Intergenic
976019141 4:80598733-80598755 CAATGTCACCTAGAGGAGGAAGG - Intronic
980822498 4:138035990-138036012 CATTGTCCCTCTGAGGAGATTGG - Intergenic
982578144 4:157143829-157143851 CATCTTCACCCTGAGGAGGCAGG + Exonic
986331417 5:6718728-6718750 CAATTTCACCTTGTGGAGCTTGG - Intronic
988159758 5:27503741-27503763 CCATGTCACCATTAGGATGTTGG + Intergenic
996315349 5:122154741-122154763 CCATGCCACACTGAGGAGTTTGG - Intronic
997573173 5:134949120-134949142 TCATGTCTCCCTGAGGAAGTGGG - Intronic
997734775 5:136205189-136205211 CAAAGCCAACCTGGGGAGGTTGG + Intergenic
999327733 5:150653553-150653575 CAGTGCCACCCTGAGCAGGGAGG - Exonic
999327991 5:150655336-150655358 CAGTGTCACCCTGAGCAGGGAGG - Intronic
999471947 5:151862900-151862922 CAATGTCACTCTGAAAATGTAGG + Intronic
1002130469 5:177078435-177078457 GAATGTCAGGCTGAGGAGCTGGG + Intronic
1002978980 6:2115249-2115271 CTATATCACACTGAGGAGGAGGG + Intronic
1007318328 6:41007899-41007921 CACTGTCACCCTCAGGGGGGAGG + Intergenic
1010087537 6:71938200-71938222 CCAGGTCACACTGAGGGGGTAGG + Intronic
1016833447 6:148454692-148454714 CACTGTCAGCGTGAGGAGGTGGG + Intronic
1018890546 6:167978413-167978435 AAATGTCACACTGTGGAGGGCGG + Intergenic
1019193884 6:170269846-170269868 AAATGTCACCCTCAGGCGTTGGG - Intergenic
1022452258 7:30525946-30525968 CAAAGTCACCCTGGGGAGATTGG + Intronic
1023838199 7:44080617-44080639 CAATGTCCTTCAGAGGAGGTGGG - Intronic
1023943241 7:44783606-44783628 CAATGTCTCTCTGAGAATGTAGG + Intergenic
1025927009 7:65968348-65968370 CAAAGTGGCCCAGAGGAGGTAGG + Intronic
1026446614 7:70490099-70490121 AAATTCCACCATGAGGAGGTAGG + Intronic
1029491424 7:100872546-100872568 CAATGGAACCCAGAGAAGGTGGG - Intronic
1030662719 7:112238907-112238929 AAATGTCATCCGGATGAGGTCGG - Intronic
1030849723 7:114468427-114468449 CAATGTCACCTTAAGTAGTTTGG - Intronic
1031024352 7:116663878-116663900 CAAGGTCACCATCAGGAGGGAGG + Intergenic
1034688984 7:152998931-152998953 CAATGTCCCACTGATGAGGCTGG + Intergenic
1035221653 7:157409923-157409945 CACTGTCTCTCTGAGGAGGAGGG + Exonic
1035519524 8:266038-266060 CAGTGTCCCCCTGGGGAGGGGGG + Intergenic
1035713906 8:1739377-1739399 CAATGTCAGCCTGAGGTTTTGGG - Intergenic
1036628063 8:10488549-10488571 AAATATCACACTGAAGAGGTAGG - Intergenic
1036982933 8:13491321-13491343 TAATGTCACTATGAGGAAGTTGG - Intronic
1037785120 8:21898189-21898211 CACTGTCAGCCTCAGGAGTTTGG - Intergenic
1044573223 8:93742424-93742446 GGATGTCACTCTGAGGAGGTAGG + Intergenic
1046364141 8:113204089-113204111 CAATTTCATCATGAAGAGGTAGG + Intronic
1048744261 8:137595876-137595898 CCAGGGCACCCTGAGGAGGTTGG - Intergenic
1048848072 8:138618319-138618341 CTATGTCAGCCAGAGGAGCTTGG + Intronic
1056865640 9:90225613-90225635 CAATGTCTCCCTGAAGATGGTGG - Intergenic
1057824663 9:98362989-98363011 GAATGTCACACAGAGGAGCTTGG - Intronic
1057974945 9:99595483-99595505 CCATGGGACCCTGAGGAGGAAGG - Intergenic
1059655611 9:116354871-116354893 AAATGTCACCCTAAGGAGTTGGG - Intronic
1062340648 9:136092570-136092592 AAATGTCACCCTGAAGTGGAAGG + Intronic
1062372866 9:136249179-136249201 CTAGGACACCATGAGGAGGTGGG + Intergenic
1186130584 X:6461327-6461349 AAATGTCTTCCTGAGGGGGTTGG + Intergenic
1186194530 X:7097883-7097905 CTAAGTCAGCCTGAGGAGGAAGG + Intronic
1186460574 X:9745435-9745457 CTCTGGCAGCCTGAGGAGGTGGG + Intronic
1190604491 X:52126730-52126752 CAAAGCCACCCAGAGGAGGATGG - Intergenic
1190735869 X:53255874-53255896 CAGTGTCGCCCTGAGGAAGCAGG - Exonic
1193338466 X:80318627-80318649 CAATGTCATCATGTGGAGTTGGG + Intergenic
1194129688 X:90066082-90066104 GAAAGTGACCCTGAGGAGATTGG + Intergenic
1194918785 X:99737639-99737661 CAATGTTACCCTGTGAATGTAGG - Intergenic
1195473548 X:105260057-105260079 CAAAGTCACCTGAAGGAGGTGGG + Intronic