ID: 1107108609

View in Genome Browser
Species Human (GRCh38)
Location 13:36673118-36673140
Sequence CAGCAGAACCAGATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107108606_1107108609 2 Left 1107108606 13:36673093-36673115 CCACTAATAGGTCTCACGGTGAA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG 0: 1
1: 0
2: 0
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107108609 Original CRISPR CAGCAGAACCAGATGGAGTA GGG Intergenic
900078393 1:836295-836317 CAGCAGAGCCACATGGAGCCAGG - Intergenic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
902316000 1:15618887-15618909 CAGCAGAACAAGCTGCAGTTGGG - Intronic
902968430 1:20029246-20029268 CAGCAGAACTACATGGAGTTTGG - Intronic
903377265 1:22874647-22874669 CGTCACAATCAGATGGAGTAGGG - Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906944662 1:50285483-50285505 CAGCTGAGCCAGATGAAGTGGGG - Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
912938948 1:114028113-114028135 CAACAGAACAAGTTGGAGTTAGG + Intergenic
914774031 1:150719691-150719713 CAGTAGAACCATTTTGAGTAGGG + Intronic
915726183 1:158019335-158019357 CAGAAGGACCAGATGGATTCTGG + Intronic
917903261 1:179564694-179564716 ACGCAGAACCAGATGGAAAAAGG + Exonic
922096534 1:222447744-222447766 CAGCAGAACCACAGGGAGTCTGG - Intergenic
922649105 1:227321456-227321478 CATCATAACCATATGAAGTAGGG + Intergenic
924374168 1:243388431-243388453 CTTCAGAACCACATGGAATAAGG + Intronic
924697812 1:246418741-246418763 CAGCAGAACGACGTGGAGTTTGG - Intronic
1062880040 10:970798-970820 AAGCAGAGCCAGAGGGATTAGGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1065252341 10:23828315-23828337 CAGCAATAGCAGATGGAGTAGGG + Intronic
1066456928 10:35580626-35580648 CAGCAGAACCTGCTAAAGTAGGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068145760 10:53068194-53068216 CAGCAGCAGAAGATGGACTAAGG + Intergenic
1068310379 10:55266748-55266770 CAGCAGAACCACACAGAGTCTGG + Intronic
1069057715 10:63862213-63862235 CATCAGAACCATGTGGAGTAAGG + Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1072706371 10:97684077-97684099 CAGCAAAACAACATAGAGTAGGG - Intronic
1075682483 10:124342581-124342603 CAGCAGAAGCAGATGGCCTCAGG + Intergenic
1075781509 10:125020410-125020432 AAGCAGTTCCACATGGAGTAGGG - Intronic
1076014352 10:127015647-127015669 CAGCAGAACCACGGGGAGTTGGG - Intronic
1076459999 10:130635739-130635761 GGGCAGAACCAGATGGAGTCTGG - Intergenic
1076657652 10:132035715-132035737 CATCAGGGCCAGCTGGAGTAGGG - Intergenic
1078152505 11:8771330-8771352 AAGCAGAATCATATAGAGTATGG + Intronic
1080798404 11:35587254-35587276 CAAGAGACCCAGATTGAGTATGG + Intergenic
1081631823 11:44694501-44694523 CAGCAGAACATGCTGCAGTAGGG - Intergenic
1082173325 11:49032350-49032372 CACCAGAACCAGATGCTGGAAGG + Exonic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084224893 11:67709993-67710015 CAGCAAAACCAGTCGGAGTTGGG - Intergenic
1084262713 11:67989836-67989858 CAGCAAAACCAGTCGGAGTTGGG - Intergenic
1086692435 11:89803697-89803719 CACCAGAACCAGATGCTGGAAGG - Exonic
1086696713 11:89855721-89855743 CACCAGAACCAGATGCTGGAAGG + Intergenic
1086709445 11:89988769-89988791 CACCAGAACCAGATGCTGGAAGG - Intergenic
1086713363 11:90035962-90035984 CACCAGAACCAGATGCTGGAAGG + Exonic
1087461957 11:98456838-98456860 CAGCAGAACAACATGAAGTTTGG - Intergenic
1088187284 11:107185156-107185178 CAGCAGTACCAGATGGTGAGAGG + Intergenic
1090669962 11:128939208-128939230 CCCCAGAACCAGATGGGGAAGGG - Intronic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1091105228 11:132912765-132912787 CAGCAGCAGCACATGGAATATGG - Intronic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1097395338 12:59066486-59066508 TAACAGAACCAGGTGGAGGAAGG + Intergenic
1100607279 12:96162111-96162133 CATAAGCACCAGATGGAGAAGGG - Intergenic
1100705696 12:97197897-97197919 CAGCAGAACCAGAAGAGGTAAGG + Intergenic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1104296100 12:127515021-127515043 CAGAAGAACATGATGTAGTATGG + Intergenic
1105607450 13:21938114-21938136 CAATTGAACCAGATGGATTAGGG + Intergenic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107649874 13:42534535-42534557 CAGCAGCATCAGATGGATTGTGG + Intergenic
1107695266 13:42993566-42993588 CATCAGAACCACTTGGAGGAGGG + Intergenic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1117625755 14:57636139-57636161 CAGGAGAACCAGTAGGAGTTAGG + Intronic
1117741285 14:58821732-58821754 CATCAGAACCAGATGGAACTGGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1120516209 14:85473702-85473724 CAGCAGAATCATATGGGGTAAGG + Intergenic
1121184761 14:91956867-91956889 CAGCAGAACAAGTTGGAGACAGG + Intergenic
1121413416 14:93763002-93763024 CAGCAGAACAAGCTGGGGTCGGG - Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG + Intergenic
1122104012 14:99437392-99437414 CAGCAGAAAGAGTGGGAGTAGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1126611355 15:50532651-50532673 CATCAGAACCAGATAGCGCAGGG + Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129801253 15:78416345-78416367 CAGCAGACCCAGCAGAAGTATGG - Intergenic
1130075455 15:80685349-80685371 CAGCAGAAGCCGAAGAAGTATGG + Intronic
1132166264 15:99594375-99594397 TAGCACAACCAGATAGAGGATGG - Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133155869 16:3875476-3875498 CACCAGAACCAGAGGGAAAAGGG + Intronic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1134625458 16:15719749-15719771 CAGCAGAACTTGGGGGAGTAAGG - Intronic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1136685979 16:31995189-31995211 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136786591 16:32938722-32938744 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136883178 16:33915072-33915094 CTGCAGAACCAGAAGGCATAAGG + Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137440969 16:48498267-48498289 CAGCAGAACCAGCTCAAGAAAGG + Intergenic
1138849136 16:60605385-60605407 CAGCAGAACAATGTGGAGTTTGG - Intergenic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1141051759 16:80771957-80771979 CAGCAGAACCAGGGAGAATAAGG + Intronic
1203088826 16_KI270728v1_random:1200388-1200410 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1142511241 17:394830-394852 CAGCAGGATCCGATGGAGCACGG + Intergenic
1143490808 17:7284290-7284312 CAGCAGGACCAGCTGCAGGAGGG - Exonic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1145822988 17:27854518-27854540 CAGCAGAGCAAGATGGAGCTGGG - Intronic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147146939 17:38490854-38490876 CTGCAGAACCAGAAGGCATAAGG - Intronic
1147497061 17:40926829-40926851 CAACAGAACCAGACAGTGTAGGG - Intronic
1151157409 17:72135556-72135578 AAGCAGAACTAGAAGGAGTCTGG + Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1154283194 18:13026864-13026886 CAGCAGAACCAGATATGGCAGGG - Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1158497595 18:57970444-57970466 CACCAGATCCAGGTGGAGGAGGG + Intergenic
1159108866 18:64032985-64033007 CATCAGATCCAGAGGGAGCAAGG - Intergenic
1159328065 18:66949573-66949595 CAGCAGGACCAGACGGAGTTTGG - Intergenic
1161671569 19:5614489-5614511 CAGCAGTACCAGACTGAGAAAGG + Intronic
1162308222 19:9888602-9888624 TGGCGGAAGCAGATGGAGTAGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164531293 19:29050209-29050231 CAGCAGAACCAAGTGGAGCTGGG + Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1166168266 19:41007920-41007942 CAGAAGAACCAGAAGCAGTCTGG - Intronic
925011181 2:487690-487712 CAGCAGAACCAGAACGAATGCGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
929795902 2:45058267-45058289 CAGCAGAACCACAAGGCTTAAGG + Intergenic
930427991 2:51235267-51235289 CATGAGAACAACATGGAGTAGGG + Intergenic
930611840 2:53553524-53553546 CAGAGGCACCACATGGAGTAGGG + Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931355961 2:61537917-61537939 CAGCAGAAGCGGCAGGAGTAGGG + Exonic
932703983 2:74009444-74009466 CAGCAGGGCCTGATGCAGTAGGG - Intronic
934919303 2:98330064-98330086 CAGCAGTCCCAGATGTTGTAGGG - Intergenic
935882199 2:107575855-107575877 CAGCAGAACTATATGGAGTTTGG + Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937991736 2:127666213-127666235 CAGCAGAAAGTGGTGGAGTAAGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942791356 2:179765114-179765136 AAGCAGAACCAGTAGGAGAAAGG - Intronic
944403240 2:199352687-199352709 CAGAAGAACTAGGTGGAGGAGGG + Intronic
945491319 2:210458613-210458635 CAGCAGAACCTGGTGGGGGATGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
947125681 2:226866027-226866049 CAGCAGATCCACATGGAGATGGG + Intronic
947324931 2:228963579-228963601 CCCAAGGACCAGATGGAGTATGG - Intronic
948076477 2:235168709-235168731 CAGCAGGGCCAGATGGGGAAGGG + Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170270990 20:14527118-14527140 CAGCAGAACGACATGGAGTTTGG - Intronic
1173322974 20:42005978-42006000 CAGCAGCAGCATGTGGAGTAAGG - Intergenic
1175016858 20:55800775-55800797 CAGCAGAGCTAAATGCAGTATGG + Intergenic
1175605483 20:60308825-60308847 CACCAGAACCAGATGCTGTATGG - Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1178455990 21:32752088-32752110 CAGCAGAACCAAAGGGACTGAGG - Intronic
1178660234 21:34501669-34501691 CAGCAGAACCTGAGGGTGTAAGG + Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1183715460 22:39530754-39530776 CAACAAAAACAGCTGGAGTAGGG + Intronic
1184664550 22:45981205-45981227 CAGAAGAACCCCATGGAGTGTGG - Intergenic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
949406342 3:3718644-3718666 CAGCACAGCCAGCTGGAGAATGG + Intronic
949828325 3:8186129-8186151 CTGCAGAACAAGGTGGAGTTTGG - Intergenic
949904887 3:8851037-8851059 CAGCAGAACCAGATGCTTTAGGG + Intronic
949949564 3:9217912-9217934 CAGGAGAGCCAGATGCAGTGGGG - Intronic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
950284061 3:11731105-11731127 CAGCAGCACTACATGCAGTAGGG - Intergenic
950437196 3:12987072-12987094 CCGCAGCACCAGATGGGGGACGG - Intronic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
954736595 3:52712724-52712746 CAGCAGAACGAGGTGGAGTTTGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956778598 3:72587070-72587092 CAGCACAACAACATGGAGTTTGG + Intergenic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961917018 3:130386906-130386928 GAGCAGATGCAGATGGAGTGAGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
969021225 4:4141751-4141773 CAGCAAAACCAGTCGGAGTTGGG - Intergenic
969732642 4:8965669-8965691 CAGCAAAACCAGTCGGAGTTGGG + Intergenic
969792223 4:9499748-9499770 CAGCAAAACCAGTCGGAGTTGGG + Intergenic
971270527 4:25140221-25140243 CAGCAGGACCACCTGGAGTCAGG + Intronic
974783718 4:66589636-66589658 CATTAGAAATAGATGGAGTAGGG + Intergenic
977128243 4:93198501-93198523 CAGCTGAACCAGAGGGACTAAGG + Intronic
977685172 4:99839067-99839089 CAGTAGATCCAGTTGGACTAGGG + Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
981016549 4:139979878-139979900 CAGCAGCACAAAATGGACTAAGG + Intronic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
986021902 5:3812388-3812410 AAGCAGAGCCAGATGGTGTGGGG + Intergenic
986199172 5:5565813-5565835 AAACAAAAGCAGATGGAGTACGG - Intergenic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
988656497 5:33217617-33217639 AAGAAGAACCAGATGGCATAAGG + Intergenic
988963036 5:36388435-36388457 TAGCATAACTAGATGGCGTAGGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
993628457 5:90254592-90254614 CAGCATAACCAGATATATTAAGG + Intergenic
994871214 5:105351959-105351981 CAGCGGAACGACATGGAGTTTGG - Intergenic
996994417 5:129677830-129677852 CAACAGAACCAGATGTGGTCTGG - Intronic
998009848 5:138685998-138686020 CACCAGAACCACATGGAATGGGG - Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999297409 5:150468412-150468434 CAGCAGTGGCAGATGGAGCAGGG - Intergenic
1000082798 5:157863486-157863508 TAGTAGAACCACATGGAGTGGGG + Intergenic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1003942394 6:11043155-11043177 GAGCAAAATCAGATGGAGTGGGG + Intronic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1006208911 6:32375955-32375977 CAGCGGAACAAAATGGAGTTTGG + Intergenic
1007143072 6:39596147-39596169 CAGGTCAACCAGATGGAGTTTGG + Exonic
1007177470 6:39906679-39906701 CAGCAGAACCAGCTCAAGAAAGG - Exonic
1007280585 6:40709459-40709481 GAGCAGTACCAAATGGAGCATGG + Intergenic
1007782870 6:44264290-44264312 CTCCAGACCCAGATGGAGTTTGG - Intronic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012440182 6:99255103-99255125 CGGCAGAACCACATGGAGTTTGG + Intergenic
1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG + Intergenic
1015073920 6:129131930-129131952 CAGAAGAACGTGATGGAGAAGGG - Intronic
1016109567 6:140205989-140206011 CAGCAGAACAACGTGGAGTTTGG + Intergenic
1016932706 6:149426081-149426103 CAGCAGAATCAGATGGCATAAGG - Intergenic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1017397263 6:154016817-154016839 CAGCAGAAAGAGACGGAGTCTGG + Intronic
1017624897 6:156338391-156338413 AAGAAGCACCAGATGGGGTAGGG - Intergenic
1018265818 6:162023493-162023515 CAGCAGAACCACGTGGAGTTTGG - Intronic
1019011204 6:168844818-168844840 CAACAGAACCAGATAGAGAGAGG - Intergenic
1021008791 7:15436205-15436227 CAGCAGAACAAAATGGACTAAGG - Intronic
1021560678 7:21965972-21965994 GAGCAGGACCAGTTGGAGTTAGG - Intergenic
1022048517 7:26643200-26643222 CAGCAGGAACAGACGGAGTGGGG - Intronic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1024267670 7:47619230-47619252 CAGCAGAACAACAGGGAGTTTGG + Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033242485 7:139691650-139691672 CAGCAAAACCAGCTGGGATAAGG + Intronic
1034077845 7:148249861-148249883 CTGCAGAACAGGATGGAGTCTGG - Intronic
1037613259 8:20494618-20494640 CAGCACACCCAAATGGAGAAGGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039390020 8:37171938-37171960 CAGCGGAACGACATGGAGTTTGG - Intergenic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041586239 8:59523398-59523420 CAGCAGAACAATGTGGAGTTTGG + Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1048105060 8:131398837-131398859 CATCAGAACCACATGAAGGAAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048829564 8:138463158-138463180 CAACAGAACCCGATGAAGCAAGG - Intronic
1055906222 9:81296076-81296098 CATCAGAACCAGACAGTGTAGGG + Intergenic
1056804741 9:89719877-89719899 CAGCAGACCTGGATAGAGTAAGG - Intergenic
1058007914 9:99939235-99939257 AAGCAAAACCAGATAGAGAATGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1061999477 9:134208672-134208694 TGGCAGAGCCAGATGGAGAATGG - Intergenic
1187800274 X:23054161-23054183 CATCAGAACCAGATATAGTAGGG + Intergenic
1190074924 X:47309969-47309991 CAGCAGCACCAGATGGAACCAGG - Intergenic
1192543960 X:71997312-71997334 TAGCAGATCCACATAGAGTAAGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193234789 X:79093608-79093630 CAGCAGGACCTGATGGAGATAGG + Intergenic
1193416397 X:81229619-81229641 CAGCAGAACGACATGGAGTTTGG - Intronic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1198064228 X:133080445-133080467 CAGCAGAAAGACATGGAATAGGG + Intronic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1200065460 X:153502392-153502414 CAGGAGAGCAAGATGGAGTGGGG - Intronic