ID: 1107111701

View in Genome Browser
Species Human (GRCh38)
Location 13:36704866-36704888
Sequence CATTATCACTCATAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107111701_1107111708 26 Left 1107111701 13:36704866-36704888 CCTGTGGCTTATGAGTGATAATG No data
Right 1107111708 13:36704915-36704937 ATCAAACTTGAAGTGATCCTAGG No data
1107111701_1107111704 -10 Left 1107111701 13:36704866-36704888 CCTGTGGCTTATGAGTGATAATG No data
Right 1107111704 13:36704879-36704901 AGTGATAATGAAGGTGCTGAGGG No data
1107111701_1107111705 -4 Left 1107111701 13:36704866-36704888 CCTGTGGCTTATGAGTGATAATG No data
Right 1107111705 13:36704885-36704907 AATGAAGGTGCTGAGGGATTTGG No data
1107111701_1107111706 -3 Left 1107111701 13:36704866-36704888 CCTGTGGCTTATGAGTGATAATG No data
Right 1107111706 13:36704886-36704908 ATGAAGGTGCTGAGGGATTTGGG No data
1107111701_1107111707 -2 Left 1107111701 13:36704866-36704888 CCTGTGGCTTATGAGTGATAATG No data
Right 1107111707 13:36704887-36704909 TGAAGGTGCTGAGGGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107111701 Original CRISPR CATTATCACTCATAAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr