ID: 1107118499

View in Genome Browser
Species Human (GRCh38)
Location 13:36773101-36773123
Sequence CTGTGGGCCTGGAATGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107118494_1107118499 17 Left 1107118494 13:36773061-36773083 CCTTGTTGAGAATCTCAACAAAT No data
Right 1107118499 13:36773101-36773123 CTGTGGGCCTGGAATGAGTAGGG No data
1107118493_1107118499 23 Left 1107118493 13:36773055-36773077 CCTACTCCTTGTTGAGAATCTCA No data
Right 1107118499 13:36773101-36773123 CTGTGGGCCTGGAATGAGTAGGG No data
1107118492_1107118499 30 Left 1107118492 13:36773048-36773070 CCTGGAACCTACTCCTTGTTGAG No data
Right 1107118499 13:36773101-36773123 CTGTGGGCCTGGAATGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107118499 Original CRISPR CTGTGGGCCTGGAATGAGTA GGG Intergenic
No off target data available for this crispr