ID: 1107120727

View in Genome Browser
Species Human (GRCh38)
Location 13:36792633-36792655
Sequence CATCACTATGGGCACCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107120724_1107120727 -8 Left 1107120724 13:36792618-36792640 CCATTTCAGAAATCACATCACTA 0: 1
1: 0
2: 2
3: 30
4: 310
Right 1107120727 13:36792633-36792655 CATCACTATGGGCACCACTGAGG 0: 1
1: 0
2: 1
3: 14
4: 159
1107120723_1107120727 -7 Left 1107120723 13:36792617-36792639 CCCATTTCAGAAATCACATCACT 0: 1
1: 0
2: 4
3: 32
4: 338
Right 1107120727 13:36792633-36792655 CATCACTATGGGCACCACTGAGG 0: 1
1: 0
2: 1
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107120727 Original CRISPR CATCACTATGGGCACCACTG AGG Intergenic
908277232 1:62486767-62486789 CTTGACTATGAGCACTACTGAGG - Intronic
908978859 1:69929563-69929585 CCTTATTATGGCCACCACTGTGG + Intronic
915064784 1:153215809-153215831 CATCACCATGAGCCCCATTGAGG - Intergenic
915841297 1:159215544-159215566 GATCAATATTGGCATCACTGGGG + Intergenic
919757300 1:201074123-201074145 CAGCAGCATGGGCACCACCGGGG + Intronic
921063348 1:211605202-211605224 CAGCACAATGGGCAGCACAGAGG + Intergenic
1063611660 10:7568019-7568041 CATCATTATGAACATCACTGGGG + Intronic
1066651485 10:37660454-37660476 AATCACTATGGGAAACACCGTGG + Intergenic
1067533802 10:47093383-47093405 CACCACTATGGCCACCACTATGG - Intergenic
1069500353 10:68947466-68947488 CATCACTATGCTAACCACTGGGG + Intergenic
1069781579 10:70959480-70959502 CCTCATTCTGGGTACCACTGGGG - Intergenic
1070005418 10:72419765-72419787 AATGACTATGGGAACCTCTGAGG + Intronic
1071589300 10:86857034-86857056 CATCAGTATGCTCACCAATGAGG + Intronic
1073147502 10:101290536-101290558 CATCTCTGTGGGCTCCATTGTGG - Intergenic
1074071507 10:110074413-110074435 ACTCACTCTGGGCACCACTAGGG - Intronic
1074156888 10:110807469-110807491 CCTCACTGGGGGCACCCCTGAGG + Intronic
1075191328 10:120311820-120311842 CATCACTCTGTGACCCACTGAGG - Intergenic
1077274400 11:1697027-1697049 CAAAACTATGTACACCACTGAGG + Intergenic
1077479773 11:2808102-2808124 CACCACTGTGGGCACCACTTGGG + Intronic
1078246823 11:9581046-9581068 CATCAGTATGGTGACCTCTGTGG + Intronic
1081045890 11:38272548-38272570 CATCACTATGGAAACCAAGGAGG - Intergenic
1084703443 11:70802309-70802331 CCTCACTATGGCCACCACAGTGG + Intronic
1087152315 11:94869874-94869896 CATCACAATGTCCTCCACTGAGG - Intronic
1089281953 11:117380986-117381008 CAGGACTCTGGGCACCATTGTGG + Intronic
1090178472 11:124673214-124673236 CCTCCCCAAGGGCACCACTGAGG + Intronic
1096218329 12:49810473-49810495 CCCCACTGTGGGAACCACTGTGG - Intronic
1096966440 12:55631795-55631817 AATGACTATGGGCGCCACAGAGG + Intergenic
1099274067 12:80552857-80552879 CATCAGAATGTGCAGCACTGTGG + Intronic
1099697504 12:86040686-86040708 TAGCATTCTGGGCACCACTGGGG + Intronic
1103343777 12:120235710-120235732 CACCACTAGGGGCTCCTCTGTGG - Intronic
1107120727 13:36792633-36792655 CATCACTATGGGCACCACTGAGG + Intergenic
1107729098 13:43330334-43330356 CACCACTCTGTGGACCACTGAGG - Intronic
1107898296 13:44987954-44987976 CATCAGAATGGGAACCAGTGTGG - Intronic
1110196812 13:72798972-72798994 CAGCACCATGCACACCACTGGGG - Intronic
1110322674 13:74177718-74177740 CTTCTCCATCGGCACCACTGTGG - Intergenic
1113286840 13:108858915-108858937 CATGAGTATGGGCAGCACTTCGG + Intronic
1113512088 13:110864579-110864601 CATTACTATGAGAACAACTGGGG + Intergenic
1120190204 14:81433749-81433771 CATCATTCTGGGACCCACTGAGG - Intronic
1122129549 14:99597148-99597170 CATCACTCTGGTGACCACTGTGG - Intronic
1123824731 15:24069599-24069621 CATCACTTTGGAAACCAATGTGG + Intergenic
1124592507 15:31065824-31065846 CATCACCATGGCGAGCACTGAGG + Intronic
1126108750 15:45163457-45163479 TATCAGTATGGACACCCCTGGGG + Intronic
1127586478 15:60382929-60382951 CTTTACTTTGGTCACCACTGTGG + Intronic
1128236267 15:66069552-66069574 CATCACCATGGTCCCGACTGTGG - Intronic
1129994922 15:79996251-79996273 CATCAGCATTGGCATCACTGTGG + Intergenic
1131631353 15:94179958-94179980 AATCACTATGGGAAACACTATGG + Intergenic
1131838650 15:96414711-96414733 CAGTACTTTGAGCACCACTGTGG - Intergenic
1133331740 16:4979088-4979110 CTTGACCATGGGCACCTCTGAGG - Intronic
1134053293 16:11152692-11152714 CAAAGCTAAGGGCACCACTGTGG + Intronic
1136620394 16:31424511-31424533 CATCATCATGGGCAGCTCTGTGG + Exonic
1138460781 16:57146491-57146513 TATCACAATGGCCACCACCGGGG - Intronic
1139069292 16:63360286-63360308 CATCACCACTGTCACCACTGTGG + Intergenic
1139195883 16:64918131-64918153 CATCACCTTGGGGACCACTCAGG - Intergenic
1140747706 16:77995723-77995745 TATTCCTATGGGCACAACTGTGG + Intergenic
1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG + Intronic
1143879780 17:10021250-10021272 CACCACTATGGGCACAGCTGGGG - Intronic
1144472992 17:15561261-15561283 CAGCACTAAGGGCTCGACTGAGG + Intronic
1144923488 17:18783439-18783461 CAGCACTAAGGGCTCGACTGAGG - Intronic
1148559030 17:48595432-48595454 CAGCACTAAGGGAGCCACTGAGG - Intronic
1150901330 17:69280862-69280884 CATCACACTGGGCACTATTGTGG + Intronic
1151226214 17:72650190-72650212 GATCACTGTGAGCACCACTGGGG - Intronic
1156445267 18:37231914-37231936 CATCCCAATGGGCAGCAATGAGG - Intronic
1156510895 18:37635537-37635559 CACCACTATGGACTCAACTGGGG + Intergenic
1157816624 18:50734230-50734252 CATTACTAAGGGCAGCTCTGGGG - Intergenic
1164674766 19:30093919-30093941 TCTCACTATGTGCACCCCTGTGG + Intergenic
1164915338 19:32047455-32047477 CCTCACTATGTGACCCACTGGGG - Intergenic
1166186923 19:41145987-41146009 AATCACTATGGAAAACACTGTGG - Intergenic
1166855202 19:45779853-45779875 CACCACGATGGGCTCCGCTGGGG + Exonic
925147126 2:1588787-1588809 CAGCACCATGGGCTGCACTGTGG + Intergenic
925629795 2:5879943-5879965 CATCACTGTGGGCACAGCTCAGG - Intergenic
928136918 2:28694760-28694782 GATCACTCTGGGCAGCCCTGTGG + Intergenic
929554607 2:42917867-42917889 CATCACTGGTGGCACCTCTGTGG - Intergenic
929945822 2:46371100-46371122 CACCACTGTCTGCACCACTGTGG - Intronic
933716904 2:85368407-85368429 CATCAATATGGGGACCACCCGGG + Intronic
934020786 2:87949391-87949413 CATCACTATCAGCACCACCAAGG + Intergenic
935627171 2:105180867-105180889 CATCACAATGGCCAGAACTGGGG + Intergenic
936815491 2:116455953-116455975 CATCACTACGGGCACAGCTGGGG - Intergenic
937231234 2:120399193-120399215 CATCCTCATGGGCCCCACTGTGG + Intergenic
937364706 2:121253236-121253258 CGTCACCATGAGCAGCACTGGGG - Intronic
939231114 2:139427347-139427369 CATCACAGTGAGCACCCCTGTGG - Intergenic
941235734 2:162970686-162970708 CATCACTTCGGGCATCACTTGGG + Intergenic
943521855 2:188961617-188961639 AACCACTATGGGAACCAGTGTGG + Intergenic
946432815 2:219634670-219634692 TGCCTCTATGGGCACCACTGTGG - Intronic
1171778931 20:29400375-29400397 AATCACTATGGACAGCAGTGTGG + Intergenic
1172049806 20:32108616-32108638 CCCACCTATGGGCACCACTGTGG - Intergenic
1172196883 20:33097892-33097914 CATGACTATGGGCCCAACTTTGG + Intronic
1172470633 20:35191882-35191904 CATCACTATGGCTACCATGGGGG + Intergenic
1173322517 20:42001179-42001201 CATCAATATGCACACCACTTGGG - Intergenic
1173458405 20:43222331-43222353 CATCAATATGGTGACCTCTGAGG + Intergenic
1173478477 20:43380509-43380531 CATCACAACTGCCACCACTGCGG + Intergenic
1174552987 20:51374961-51374983 GGTCACTGTGGGCACAACTGTGG + Intergenic
1175192900 20:57223491-57223513 CAGCACTATGGGAATCACTGAGG + Intronic
1176039497 20:63056742-63056764 CATCACTACTGCAACCACTGGGG + Intergenic
1176371920 21:6067403-6067425 CAGCACTATGGGCCCATCTGGGG + Intergenic
1179584887 21:42368094-42368116 CGTCACTATGAGCACCACCCTGG - Intergenic
1179751599 21:43471136-43471158 CAGCACTATGGGCCCATCTGGGG - Intergenic
1181278166 22:21699903-21699925 CCTCAGTAAGGGCACCTCTGCGG + Exonic
950468078 3:13167358-13167380 CCTCACTATATCCACCACTGTGG + Intergenic
952950050 3:38515582-38515604 CAGCATGATGGACACCACTGAGG - Intronic
954843060 3:53530243-53530265 CATCACTATGGGAACCAGGATGG - Intronic
957086208 3:75680192-75680214 AATCACTATGGACAACAGTGTGG - Intergenic
959926063 3:111923223-111923245 CAGCAGGCTGGGCACCACTGAGG - Intronic
961361798 3:126372803-126372825 CATCTCCATGGCCACTACTGGGG - Intergenic
961418912 3:126784182-126784204 AATAAAGATGGGCACCACTGAGG - Intronic
968576265 4:1367664-1367686 CCTCGCTCTGGGAACCACTGTGG + Intronic
974897044 4:67952579-67952601 CACCATTATGGGAACCTCTGTGG - Intronic
975028577 4:69584130-69584152 CAGCACTTTGGGCACCAAGGTGG + Intergenic
976601269 4:86939896-86939918 CAACACTTTGAGAACCACTGTGG + Intronic
985709993 5:1422706-1422728 CAGCACCGTGGGCAGCACTGTGG - Intronic
985710013 5:1422780-1422802 CAGCACCGTGGGCAGCACTGTGG - Intronic
985710041 5:1422892-1422914 CAGCACCATGGGCAGCACTGTGG - Intronic
985710124 5:1423228-1423250 CAGCACCATGGGCAGCACCGTGG - Intronic
985710133 5:1423266-1423288 CAGCACCGTGGGCAGCACTGTGG - Intronic
988793737 5:34633288-34633310 CATCACCAAGGTCACCCCTGGGG - Intergenic
988809696 5:34772205-34772227 AATCACTATGCACACAACTGGGG - Intronic
988893374 5:35644862-35644884 CATGACCATTGTCACCACTGAGG + Intronic
989531386 5:42512116-42512138 CAGCACTGTGGCCATCACTGTGG - Intronic
990403178 5:55460935-55460957 CAGCACTTTGGGCACCAAGGTGG + Intronic
991246604 5:64514767-64514789 CAACAGTATTAGCACCACTGAGG - Intronic
992647405 5:78824445-78824467 CAGCAGTATTGGCACCACTCAGG + Intronic
993190732 5:84677103-84677125 CATCTATATAGGCACAACTGAGG + Intergenic
993504478 5:88693376-88693398 AATCACTCTTGGCACCACTTGGG + Intergenic
994031601 5:95149675-95149697 CATGACTGTGGCCTCCACTGGGG + Intronic
994092457 5:95821270-95821292 CACTACTACGGGCCCCACTGTGG - Intronic
995240514 5:109881120-109881142 CATCACTATGGTAACAACCGTGG + Intergenic
995414355 5:111892191-111892213 CATTACTATGGGTACCTATGAGG + Intronic
995911416 5:117192219-117192241 AATCACTATTTGTACCACTGAGG - Intergenic
996396933 5:123022638-123022660 CATCAATATGGTGGCCACTGGGG - Intronic
997254402 5:132417320-132417342 CATCCCCACGGCCACCACTGTGG + Intronic
999114172 5:149147939-149147961 GATCACTGTGGGCATCATTGTGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1006239165 6:32662232-32662254 GGTCACTGTGGGCTCCACTGAGG + Exonic
1006248304 6:32759115-32759137 GGTCACTGTGGGCTCCACTGAGG + Exonic
1006439752 6:34046654-34046676 CATCCCTGTGTGCACCAATGGGG - Intronic
1007594095 6:43040773-43040795 CCTCAGTGTGGGCACCAGTGTGG + Intronic
1009347235 6:62629086-62629108 GGACACTATGGGCACCAGTGAGG + Intergenic
1009513994 6:64590721-64590743 CATAACTATGGGACCCACTGAGG - Exonic
1009941148 6:70289309-70289331 CAACACTATGGGCACAGCTGAGG + Intronic
1011290362 6:85770593-85770615 AACCACTATGGGAAACACTGTGG - Intergenic
1014781010 6:125564679-125564701 CATCACTACAGACATCACTGAGG + Intergenic
1016118427 6:140317130-140317152 CCTCACCTTGGGCCCCACTGTGG + Intergenic
1017558029 6:155594102-155594124 CATCAGTGTGGTCAACACTGAGG + Intergenic
1018342562 6:162867410-162867432 CATCACTGTGGGAAACACAGTGG + Intronic
1023124609 7:36943071-36943093 CCTCACCATGAGCACCTCTGAGG - Intronic
1024358793 7:48446010-48446032 CATCAGTGTGGCCAACACTGTGG - Intronic
1028917759 7:96278302-96278324 CATCACTATGGCTACCAGTGTGG - Intronic
1032332187 7:130990860-130990882 GGTCACTATGGTCAGCACTGAGG - Intergenic
1033582161 7:142748146-142748168 CAACACCATGGGCCCCACTTTGG + Intergenic
1035062382 7:156079223-156079245 CTTCACCATGGGCAACGCTGCGG - Intergenic
1035593080 8:833061-833083 CATCCCCATGAGCAGCACTGGGG + Intergenic
1037590949 8:20311572-20311594 CATCACTGAGGTCAACACTGAGG + Intergenic
1039489075 8:37934367-37934389 CATCACTGAGGGCATCAATGAGG - Exonic
1040590031 8:48782982-48783004 CAGCACTTGGGGCACCACTAAGG + Intergenic
1040799216 8:51322593-51322615 GACCAATATGGGCTCCACTGAGG + Intronic
1045942168 8:107751814-107751836 CCTCACTCTGGGCACCTCTATGG - Intergenic
1046474893 8:114729335-114729357 CTGCACTATGGACAACACTGTGG - Intergenic
1049710134 8:144059712-144059734 CATCCGCATGGGCACCACAGTGG - Exonic
1050365988 9:4874201-4874223 CATCAGTGTGGGCACTGCTGTGG + Intronic
1055987801 9:82069439-82069461 CTCCACTATCAGCACCACTGGGG + Intergenic
1056220021 9:84442674-84442696 GATCACTAAGGGCTCCACTGAGG + Intergenic
1058657812 9:107240459-107240481 CAGCATCATGGGCATCACTGGGG - Intergenic
1060573918 9:124670927-124670949 CATCTCTACTGCCACCACTGTGG - Intronic
1062422133 9:136487871-136487893 CCTCTGTATGGGCACCTCTGTGG - Intergenic
1185667525 X:1778150-1778172 AACCACTATGGAAACCACTGCGG - Intergenic
1185821185 X:3206408-3206430 CATTTCTGTGGGCTCCACTGTGG + Intergenic
1189380362 X:40498544-40498566 CATCAACACGGGCACCACAGGGG - Intergenic
1190001066 X:46687317-46687339 GATCAGTGTGGCCACCACTGTGG + Intronic
1192505538 X:71679928-71679950 CCCCACTGTGGCCACCACTGGGG + Intergenic
1192689205 X:73343129-73343151 CATCACTATGTGGCCCCCTGGGG - Intergenic
1192806379 X:74513033-74513055 AATAACTCTGGGAACCACTGAGG + Intronic
1196787596 X:119434644-119434666 CATCACTATGGTGACCTCTCGGG + Intronic
1197279740 X:124521132-124521154 CAGCACTATGGGCTCCATTAAGG + Intronic
1197445738 X:126551501-126551523 CATCACTGTGGGCACCGGTCAGG - Exonic
1199123738 X:144089736-144089758 CATCACTATCAGCACCACCAAGG - Intergenic
1199154074 X:144525683-144525705 CAGGACTGTGGGCTCCACTGTGG + Intergenic