ID: 1107123725

View in Genome Browser
Species Human (GRCh38)
Location 13:36821709-36821731
Sequence GTGAATTAAGTATGACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107123725_1107123728 27 Left 1107123725 13:36821709-36821731 CCAGTGTGTCATACTTAATTCAC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1107123728 13:36821759-36821781 TCCCTTAAGTTTTACTCTTTTGG 0: 1
1: 0
2: 1
3: 27
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107123725 Original CRISPR GTGAATTAAGTATGACACAC TGG (reversed) Intronic
904195002 1:28778651-28778673 GTGAATTAAAAATGAGACACCGG - Intergenic
904418702 1:30377955-30377977 GTGAATTACGAATGACTCAGGGG - Intergenic
904788182 1:32998170-32998192 GGGAAGGAAGTATGAGACACAGG + Intergenic
908912622 1:69089678-69089700 GTCAATTAAGTGAGACACAGAGG - Intergenic
909725451 1:78829355-78829377 GGGAATTGTGTCTGACACACAGG - Intergenic
911754828 1:101541309-101541331 GTCAATCAAGTATGGCACAAGGG + Intergenic
912212851 1:107573602-107573624 GTAAATTAAGTATAATACAGGGG + Intronic
913095333 1:115511000-115511022 GTGAATTATGTCTGACAGAAGGG + Intergenic
917886940 1:179395817-179395839 GTGAAACAAGTATGACATAATGG - Intronic
922164409 1:223103018-223103040 GTGATTTAAGGAAGACACTCAGG - Intergenic
922279861 1:224113643-224113665 GTGAAATAAGTTAGACACAAAGG - Intergenic
922586904 1:226740215-226740237 GAGAATTATGTAAAACACACTGG - Intergenic
923316876 1:232789054-232789076 GAAAATTGAGTAAGACACACGGG - Intergenic
1062850759 10:740723-740745 GTGAATTAAGCCAGACACAGAGG - Intergenic
1067371339 10:45685964-45685986 GTAAATAACGTATCACACACTGG - Intergenic
1067417622 10:46116772-46116794 GTAAATAACGTATCACACACTGG - Intergenic
1067503036 10:46823660-46823682 GTAAATAACGTATCACACACTGG - Intergenic
1067874810 10:49995880-49995902 GTAAATAACGTATCACACACTGG - Intronic
1068361260 10:55976986-55977008 GTGAATTATGTCTGACAGAAGGG - Intergenic
1070135275 10:73688863-73688885 GTAAATAACGTATCACACACTGG + Intronic
1071826822 10:89333715-89333737 GTAATTTAAGTATGAGAAACTGG + Intronic
1074943109 10:118254221-118254243 GAGGATTAAGAATGGCACACTGG + Intergenic
1074943827 10:118261093-118261115 GTGTATGAAGCCTGACACACAGG - Intergenic
1076895570 10:133309623-133309645 ATGAATTAAGTTTCACAAACAGG - Intronic
1079415467 11:20231549-20231571 GTGAATAAAGTCAGACACAAAGG + Intergenic
1081423020 11:42894508-42894530 GTCAAGTAAGTATGGCACTCTGG - Intergenic
1082615262 11:55352294-55352316 GGACATTAAGTATGACAAACAGG - Intergenic
1087763448 11:102125679-102125701 GTAAATTAAGAATGATACACAGG - Intronic
1088622112 11:111696034-111696056 GTTAATTAAGTAAGAGACAGAGG + Intronic
1093971245 12:25378000-25378022 GGAAATTAAGGATGACTCACTGG - Intergenic
1098194224 12:67982821-67982843 TTGATTTTAGTTTGACACACAGG - Intergenic
1101035298 12:100699857-100699879 GTGAAATAAGTCAGACACAAAGG - Intergenic
1101208897 12:102516484-102516506 GTGAAATAAGTCAGACACAAGGG + Intergenic
1106203988 13:27572061-27572083 ATGAATTTAGTATGATACACTGG - Intronic
1107123725 13:36821709-36821731 GTGAATTAAGTATGACACACTGG - Intronic
1111193740 13:84844373-84844395 GTCAATCAAGTATGAGAAACTGG + Intergenic
1120884449 14:89441052-89441074 CTGAATTAAGTATGAGAAAGTGG + Intronic
1123181442 14:106474638-106474660 GTGAATTCAGTGTGACAGACAGG + Intergenic
1202945458 14_KI270726v1_random:22089-22111 GTGAATTCAGTGTGACAGACAGG - Intergenic
1123593213 15:21879858-21879880 GGGAATTAAGCAACACACACTGG + Intergenic
1125369783 15:38961435-38961457 GAGAATTAAATACCACACACAGG - Intergenic
1126253525 15:46597184-46597206 GAGAATAAAGTGTGATACACAGG - Intergenic
1126881869 15:53107671-53107693 GTGACATAAGTGTGACACAAAGG + Intergenic
1127857492 15:62964452-62964474 GCGCATTAAGGATGACACAGAGG - Intergenic
1133407887 16:5540379-5540401 GTCAAGTAAGTGTGAAACACTGG - Intergenic
1133584990 16:7184534-7184556 GTGATTGAAGTATGACATATTGG + Intronic
1138663455 16:58541331-58541353 TCCAATTAAGTATGACATACAGG - Intronic
1139587302 16:67912266-67912288 GTGAATTAACTGTTACACTCGGG + Intronic
1140912426 16:79466304-79466326 GTGAATGAAGGATGACTCATGGG + Intergenic
1143799810 17:9369258-9369280 CTGAATTAAGGATGACACAGCGG + Intronic
1147760158 17:42792836-42792858 GTTTATAAAGTATAACACACAGG - Intronic
1153777169 18:8464390-8464412 GTGACTTGCGTATGAGACACAGG - Intergenic
929125941 2:38522932-38522954 GTGAATTAAACAGGGCACACGGG - Intergenic
930155558 2:48104192-48104214 GTGAAAGAAGTAAGACACAAAGG + Intergenic
932746629 2:74338974-74338996 GAGAATTAAATATGATACATGGG + Intronic
934765205 2:96876675-96876697 CTGACTTAGGTCTGACACACTGG - Intronic
936582874 2:113720218-113720240 GAGACTTAAGTGTAACACACAGG + Intronic
937557593 2:123178358-123178380 GTGAAATAAGCCTGACACAAAGG + Intergenic
939268356 2:139905188-139905210 CTGAATTAAGTATGAGCCACTGG - Intergenic
940238717 2:151539779-151539801 GTGAATGATGCATGACACAGTGG - Intronic
942786218 2:179705868-179705890 GTGAGTTGAGTTTGGCACACAGG + Intronic
943054456 2:182958660-182958682 AGGAATCAAGTATGACACAGAGG + Intronic
947963896 2:234262606-234262628 GAGAATTGAGTATGAGACAAAGG - Intergenic
1172376877 20:34450268-34450290 TTGAATTAATTATTACTCACAGG - Intronic
1174942935 20:54951785-54951807 GTGAATGATGTCTGGCACACAGG - Intergenic
1175587243 20:60151152-60151174 CTGAATTAAGCATCACACATTGG - Intergenic
1182161486 22:28126743-28126765 GTCAAGTGAGTATGAAACACTGG + Intronic
1182246440 22:28961575-28961597 GTGAATTTAGTATGACATCTTGG + Intronic
954879136 3:53822253-53822275 CTGAATTAGGCATGGCACACAGG + Intronic
964588947 3:158339631-158339653 GTAAATTATGTATGACACTAAGG + Intronic
970238970 4:13988385-13988407 GTGACTTACGTAAGTCACACAGG + Intergenic
970639461 4:18048274-18048296 GTGAATCAAGGATGACTCCCGGG + Intergenic
971630726 4:28989701-28989723 GTGTATTAAAGATTACACACAGG + Intergenic
971986824 4:33837227-33837249 GTGCATTAAGTAAGAGGCACTGG + Intergenic
973879616 4:55256142-55256164 GGGGAATAAGTATGACACATGGG - Intergenic
974579267 4:63774220-63774242 GTGAATTAGGTCAGCCACACTGG - Intergenic
974869255 4:67619329-67619351 GTGAATAAATTTGGACACACTGG + Intronic
977577690 4:98692207-98692229 GTGGAATAAGTATGAAATACTGG - Intergenic
979033329 4:115679483-115679505 GGGAATTAGGAATGACACAGCGG - Intergenic
979643590 4:123039545-123039567 GTAAATTAAGTTTTACACAAGGG - Intronic
979683812 4:123489279-123489301 GTGCATAAAGTATGAAAAACTGG - Intergenic
981497965 4:145414709-145414731 GTGACTTAAGTATGAAGCATTGG - Intergenic
981687766 4:147474176-147474198 GTCAATTAAATATGATACAATGG + Intergenic
983438614 4:167750866-167750888 GTGAAGCAAGTAAAACACACAGG - Intergenic
984859420 4:184223778-184223800 TTTAATTACATATGACACACAGG + Intergenic
985286217 4:188338577-188338599 GAGAATAAAGCATGACTCACAGG - Intergenic
986030508 5:3888896-3888918 GAGAAATAAGGCTGACACACAGG + Intergenic
988248356 5:28719815-28719837 ATAAATTAAGAATCACACACCGG - Intergenic
989660270 5:43790680-43790702 GTGAATTATGTCTGACAGAAGGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992719256 5:79543671-79543693 GTGAATAAAGAATGAGAAACAGG - Intergenic
994471032 5:100207526-100207548 GTGAGTTAAGAAAGTCACACTGG - Intergenic
995952735 5:117736144-117736166 GTTAATTAAGGATGACAGAAAGG + Intergenic
996497148 5:124171761-124171783 GTAAATTAAGTATCAAAAACTGG - Intergenic
996792812 5:127311156-127311178 GTGAGTAAAGTATGAGAAACTGG - Intronic
999718828 5:154383464-154383486 GTAAAGTAAGTAGCACACACTGG + Intronic
1001125336 5:169013960-169013982 GTGCAATAACTATCACACACAGG - Intronic
1004029968 6:11858681-11858703 GTGAAATAAGTTAGACACAAAGG + Intergenic
1004879241 6:19989865-19989887 AAGAATTAAGCATGACACATAGG - Intergenic
1005087030 6:22017504-22017526 GGGAATTGAGTGTGAGACACTGG + Intergenic
1006694038 6:35915562-35915584 GTGAATTAATTGTGAAAAACTGG + Intronic
1012853246 6:104471645-104471667 GTACTTTAAGTATGACACCCAGG + Intergenic
1022199864 7:28105986-28106008 CTGTTTTAAGGATGACACACTGG + Intronic
1022546629 7:31195162-31195184 TTGAATTAAGTATAAGACCCAGG - Intergenic
1024119000 7:46218699-46218721 GTTAATTAAGTATGAGGCAATGG - Intergenic
1027463673 7:78487089-78487111 ATGAGTTAAGTGTGATACACAGG - Intronic
1031257298 7:119470258-119470280 GTGAATTTTGTTTGACACATTGG + Intergenic
1031740913 7:125429548-125429570 GTGGATTAAGTATGAAAACCTGG - Intergenic
1032396255 7:131592182-131592204 GTGAAATTAGAAAGACACACAGG - Intergenic
1032440263 7:131937410-131937432 CTGAATTGAGTCTGTCACACAGG + Intergenic
1042580598 8:70274068-70274090 GTGAATAAAGTTTGAAACAAAGG + Intronic
1042677549 8:71338767-71338789 GTGAATTATTTGTAACACACAGG - Intronic
1047707359 8:127513044-127513066 GTGATTTAAGGATGACTCACAGG + Intergenic
1048348182 8:133594014-133594036 CTGAATAAAGAATAACACACAGG - Intergenic
1052502452 9:29308854-29308876 GTTAATTAAGTTGGACACGCAGG - Intergenic
1058450377 9:105090890-105090912 GTGATGTAAGTATGACACCTGGG + Intergenic
1058850099 9:109003289-109003311 ATGAATTCAATATGACTCACAGG + Intronic
1187848835 X:23570357-23570379 TTGAATTAAGGAAGAAACACTGG - Intergenic
1190478913 X:50855442-50855464 GTGAAATAAGCCTGACACAAAGG - Intergenic
1192716252 X:73645384-73645406 TTGAAATAAGTATGACAAATGGG - Intronic
1197277716 X:124499081-124499103 GTGACTTCAGTCTGACACATGGG - Intronic
1199691561 X:150312768-150312790 GTGAACTATGAATGACACAGAGG + Intergenic