ID: 1107124215

View in Genome Browser
Species Human (GRCh38)
Location 13:36828287-36828309
Sequence GTAGTTGGGGCACCTATAAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107124208_1107124215 26 Left 1107124208 13:36828238-36828260 CCAATAACACTCCTAAGAAATGT 0: 1
1: 0
2: 2
3: 19
4: 196
Right 1107124215 13:36828287-36828309 GTAGTTGGGGCACCTATAATTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1107124210_1107124215 15 Left 1107124210 13:36828249-36828271 CCTAAGAAATGTTGATGGCTATT 0: 1
1: 0
2: 3
3: 10
4: 199
Right 1107124215 13:36828287-36828309 GTAGTTGGGGCACCTATAATTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107124215 Original CRISPR GTAGTTGGGGCACCTATAAT TGG Exonic
907778920 1:57546122-57546144 GAAGTTGGGGGACAGATAATGGG + Intronic
910767915 1:90801006-90801028 ATATTTGGGGCACCTTAAATAGG + Intergenic
911509499 1:98793768-98793790 GTAGATGGGCCAGCTACAATAGG + Intergenic
915058920 1:153163470-153163492 GTATTTGGGGCTCCTATATTTGG + Intergenic
921486627 1:215722833-215722855 ATAGTTAGGGCACAGATAATAGG + Intronic
1074869731 10:117567247-117567269 TTAGCTGGGGCACCTATATGGGG - Intergenic
1076686431 10:132200320-132200342 GTCGGTGGGGCACCTCTCATGGG + Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1107124215 13:36828287-36828309 GTAGTTGGGGCACCTATAATTGG + Exonic
1110306120 13:73988546-73988568 GTAGTTGGGGCATATGTTATTGG - Intronic
1115113899 14:29856726-29856748 GAAGTTTGGGTACCTAAAATAGG + Intronic
1128111481 15:65078973-65078995 GTAGTTGGGGCATCTAGAGAGGG + Intergenic
1128310723 15:66630472-66630494 CTAGTAGGGGCACAGATAATTGG + Intronic
1137320796 16:47379713-47379735 GTAGTTGGATCACCTTTCATGGG + Intronic
1138576101 16:57908270-57908292 GAGGTTGGGGCATCTATACTGGG + Intronic
1142313423 16:89327716-89327738 TTATTTGGAGCACCTATAAATGG - Intronic
1163350768 19:16775471-16775493 GGAGTTGGAGCAGCTATATTGGG - Intronic
1167197745 19:48042375-48042397 GTAGGTGGGGCAGCAATAACTGG - Intronic
925650697 2:6086274-6086296 GTAGCTGTGGAACTTATAATGGG - Intergenic
927166190 2:20324515-20324537 GTTGTTGGGGCACATATAGCTGG - Intronic
941919835 2:170839384-170839406 GTGGATGGGTCACCTAAAATGGG + Intronic
945741140 2:213662989-213663011 GTAATTAGGGCACCAATAATAGG + Intronic
1173818180 20:46003559-46003581 GCAGTTGGATCACCTATGATCGG - Intergenic
1180882577 22:19216761-19216783 GTATGTGAGACACCTATAATTGG - Intronic
953080316 3:39610367-39610389 GGAATTGGGGCACCTAGATTCGG + Intergenic
954867485 3:53742362-53742384 GTACCTGGAGCACCTATTATGGG - Intronic
970621361 4:17822632-17822654 TAAGTTGGGCCACCTGTAATTGG + Intronic
970664411 4:18320281-18320303 GTAGTGGGGCCATCTTTAATGGG + Intergenic
970926720 4:21460638-21460660 GAAGTTGGGACTCCCATAATGGG - Intronic
974172951 4:58291265-58291287 GTGGTTTGGGAACCTAGAATGGG + Intergenic
990170754 5:53046850-53046872 GTAGTTCTGGCACTTACAATTGG + Intronic
997053405 5:130410370-130410392 TCAGTTGGGTCACCTATCATTGG + Intergenic
1001557857 5:172648493-172648515 AGAGTTGGGGCACTAATAATAGG - Intronic
1002604625 5:180375266-180375288 GTGGCTGGGGCACTTGTAATGGG + Intergenic
1004638798 6:17494282-17494304 GGTGTTGGGGCACCAATCATGGG - Intronic
1005678727 6:28183433-28183455 GATGGTGGGGCACTTATAATGGG - Intergenic
1005810045 6:29508488-29508510 ATAGATGGAGCAGCTATAATGGG + Intergenic
1018615162 6:165679948-165679970 GTATTTGGGGTACCTATGGTGGG + Intronic
1024724365 7:52175960-52175982 GCAATTGGTGCACTTATAATAGG - Intergenic
1024832350 7:53475772-53475794 CCAGTTGGGACTCCTATAATTGG + Intergenic
1032543474 7:132723546-132723568 TTACGTGGGGCACCTAGAATAGG + Intronic
1033153142 7:138934076-138934098 GTTGTTTTGGAACCTATAATTGG + Intronic
1043778000 8:84294834-84294856 GTAGGTGGGCAACCTAGAATGGG + Intronic
1057603690 9:96482346-96482368 TTAGATGAGGCACCTAGAATAGG - Intronic
1189192705 X:39124201-39124223 GTTCTTCGGGCACCTAGAATTGG - Intergenic
1195598356 X:106718849-106718871 GTAGTTGGGACAACTGAAATTGG - Intronic