ID: 1107124413

View in Genome Browser
Species Human (GRCh38)
Location 13:36830972-36830994
Sequence GCTCTCAGAGGACTACTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107124413_1107124420 14 Left 1107124413 13:36830972-36830994 CCTACTAGTAGTCCTCTGAGAGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1107124420 13:36831009-36831031 TTCATAGTAGAATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 236
1107124413_1107124421 15 Left 1107124413 13:36830972-36830994 CCTACTAGTAGTCCTCTGAGAGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1107124421 13:36831010-36831032 TCATAGTAGAATTTTGGGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 219
1107124413_1107124419 10 Left 1107124413 13:36830972-36830994 CCTACTAGTAGTCCTCTGAGAGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1107124419 13:36831005-36831027 TTCTTTCATAGTAGAATTTTGGG 0: 1
1: 1
2: 6
3: 36
4: 523
1107124413_1107124418 9 Left 1107124413 13:36830972-36830994 CCTACTAGTAGTCCTCTGAGAGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1107124418 13:36831004-36831026 CTTCTTTCATAGTAGAATTTTGG 0: 1
1: 0
2: 1
3: 25
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107124413 Original CRISPR GCTCTCAGAGGACTACTAGT AGG (reversed) Intergenic
901189545 1:7400076-7400098 GTTTTCAGAGGACTAACAGTTGG - Intronic
906956300 1:50377696-50377718 CCTCTCAGAGGACCCCTAGTTGG + Intergenic
916955845 1:169833713-169833735 GCTCTTAGAGGGCTAATAGGTGG - Intronic
917605077 1:176619329-176619351 GCTCTAAGAAGACTACTATATGG + Intronic
918438026 1:184536603-184536625 GATATCCGAGGACAACTAGTAGG + Intronic
1073953971 10:108846023-108846045 GGTCACTGAGGAGTACTAGTGGG + Intergenic
1075592494 10:123702955-123702977 GGTCTCAGAGGACAGCTTGTGGG - Intergenic
1075992349 10:126848712-126848734 GCTATCAGAGGACCTCCAGTAGG - Intergenic
1077356595 11:2121691-2121713 GCTCTCCGAGGACTCCGAGGAGG + Intergenic
1077750829 11:4966873-4966895 ACTCTCAGAGGGCAGCTAGTAGG + Intronic
1089678220 11:120104807-120104829 GCTCACAGAGGAATCCAAGTGGG - Intergenic
1090028747 11:123189569-123189591 CCTGTCAGAGTACTACAAGTGGG + Intronic
1091888965 12:4037924-4037946 GCACTAAGAGGAGTACTGGTAGG - Intergenic
1092223473 12:6731090-6731112 GCTCTCTGAGGACTCCTAAGAGG - Exonic
1092528936 12:9328313-9328335 GCTCTCAGAGGCCTACATGCTGG + Intergenic
1096410218 12:51371779-51371801 ACTCTCATAGGGCTACTACTGGG + Intronic
1098094892 12:66944708-66944730 TCACTCAGAGGACTGCTACTGGG + Intergenic
1099102083 12:78455015-78455037 GCTCTCACTGGATTTCTAGTTGG + Intergenic
1103562635 12:121800387-121800409 GCTCTCAGAGGGCGACTGGGAGG + Intronic
1105703513 13:22951775-22951797 GCTCTCAGAGCTATAATAGTTGG + Intergenic
1105856168 13:24374014-24374036 GCTCTCAGAGATATAATAGTTGG + Intergenic
1107124413 13:36830972-36830994 GCTCTCAGAGGACTACTAGTAGG - Intergenic
1108350505 13:49586349-49586371 GCTCTCGGAGAACTCCCAGTTGG + Intergenic
1131568286 15:93506192-93506214 GCTCTCAGAAGACTCGCAGTGGG + Intergenic
1131575730 15:93588823-93588845 GCTCTCACAGTACTCCTACTAGG - Intergenic
1132408097 15:101556883-101556905 CCTCTTAGATGACTAGTAGTTGG - Intergenic
1132879129 16:2153586-2153608 GCTCTCAGAAGCCTGCTTGTTGG - Exonic
1137758684 16:50922967-50922989 GCTCTCAGAGGAATATTCCTGGG + Intergenic
1139874996 16:70138703-70138725 GCTCTCAAAAGACTACTATGAGG - Intronic
1140360789 16:74342428-74342450 GCTCTCAAAAGACTACTATGAGG + Intergenic
1149042099 17:52202409-52202431 GCTCTCTGAGGACTGCTCTTGGG + Intergenic
1159945567 18:74442138-74442160 GCTATCAAAGGGCTACTGGTGGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162398188 19:10430175-10430197 GCTCTCAGAGCACCACTGGCAGG + Intronic
933004401 2:76972165-76972187 TTTCTCAGAGAACTACTATTGGG - Intronic
934734937 2:96685412-96685434 GCTGGCAGAGGACTGCAAGTAGG + Intergenic
937438786 2:121900015-121900037 GATCCCAGAGGATTCCTAGTGGG + Intergenic
939885948 2:147681990-147682012 ACTTTCAGAGCACTACTATTGGG + Intergenic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
943876184 2:193071073-193071095 CCTCTCAGAGAACTTCTACTAGG + Intergenic
1181953063 22:26568760-26568782 CCTCCCAGAGGACTGCTGGTTGG - Intronic
1182550482 22:31098420-31098442 CTTCTCAGAGAACTACTCGTGGG + Intronic
951162611 3:19443312-19443334 GTTCCCAGAGGACTCCTAGGTGG - Intronic
954634821 3:52065706-52065728 GCTCTCTCAGGGCTCCTAGTGGG + Intergenic
955669409 3:61387569-61387591 GCACTCAGAAAACTACTAGAAGG + Intergenic
969059608 4:4424479-4424501 GCTGTCAGAGGAGGACTAGGAGG + Intronic
971113269 4:23614515-23614537 GCTGTCAGAGGACCTGTAGTTGG + Intergenic
985860520 5:2467007-2467029 GCTCTCAGAGAACTGCTGGGGGG - Intergenic
989814196 5:45715995-45716017 ACTCTGAGAAGACTACTAATTGG + Intergenic
991195030 5:63922426-63922448 GGCCTCAGAGGTCTCCTAGTTGG - Intergenic
994246899 5:97488773-97488795 GCTCTCAGGAGACTCATAGTGGG + Intergenic
1000854192 5:166379096-166379118 GCTCTCAGGAGACTGCAAGTGGG + Intergenic
1001318411 5:170660996-170661018 GCTCTCAGATGACACCTAGGTGG + Intronic
1003855874 6:10273983-10274005 GCTCTCAGTGGATGCCTAGTGGG + Intergenic
1010091955 6:71992995-71993017 ACTTTCAGAGGACTGCTAATTGG + Intronic
1011750650 6:90451500-90451522 GCTCTCTGAGGCCTGCTACTTGG + Intergenic
1021946310 7:25731216-25731238 GCTTTGAGAGGCCTTCTAGTAGG - Intergenic
1030899235 7:115102058-115102080 GCTCTCAGAGGGCTCAAAGTAGG - Intergenic
1034021683 7:147651058-147651080 GGTCTCAGAGTACTATTAGCTGG + Intronic
1034088154 7:148339176-148339198 GCTCTCAGAGCCCTCCTTGTAGG + Intronic
1046317241 8:112520486-112520508 GCTGTCAGAGTTCCACTAGTAGG - Intronic
1051568887 9:18533381-18533403 ACTCTCAGTGAAATACTAGTTGG - Intronic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1189501854 X:41568388-41568410 GCTTTCAGAGGAATCCTTGTAGG - Intronic
1192005160 X:67203924-67203946 GCTATTAGAGGACATCTAGTGGG - Intergenic
1192236839 X:69301535-69301557 GCTCGCAGAGGACCACAGGTGGG - Intergenic
1196067539 X:111481629-111481651 GCTTTGAGAAGACTAGTAGTAGG - Intergenic
1197936726 X:131747243-131747265 GTTCTCTGAGGACTACCTGTTGG - Intergenic
1198823222 X:140671969-140671991 GATCTCAGAGATCTACTAGTAGG - Intergenic