ID: 1107130084

View in Genome Browser
Species Human (GRCh38)
Location 13:36885942-36885964
Sequence GCTGACTGTTCTCACTATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107130084 Original CRISPR GCTGACTGTTCTCACTATGC GGG Intronic
902686002 1:18078111-18078133 ACTGAATGTTCTCATTATCCTGG + Intergenic
902699216 1:18160214-18160236 CCTCACTGGTCTCACTCTGCTGG + Intronic
905591163 1:39165188-39165210 GCACACAGTTCTCACTATGAAGG - Intronic
908218192 1:61976748-61976770 GCTGACTATTCTCTTTATGTTGG - Intronic
915715633 1:157942074-157942096 GCTTACTGTGCTCACTGTGCTGG - Intergenic
916998021 1:170322416-170322438 ACTGACTGTTCTCACTTTCAAGG - Intergenic
917729015 1:177855549-177855571 GCTGACTGTACTCTCTTTTCTGG + Intergenic
920720725 1:208384383-208384405 TCTGACTGTACTGCCTATGCGGG - Intergenic
1062793336 10:323215-323237 ACTGACTGTTCTAACAACGCCGG - Intronic
1062793347 10:323264-323286 ACTGACTGTTCTAACAACGCCGG - Intronic
1067476480 10:46570767-46570789 GCTGATTTTTCTGACAATGCTGG - Intergenic
1067618258 10:47771014-47771036 GCTGATTTTTCTGACAATGCTGG + Intergenic
1071971648 10:90913994-90914016 GCAGACTGACCTCACTGTGCCGG - Intronic
1076788782 10:132765363-132765385 GCTGACATTGCTCACTCTGCAGG + Intronic
1080808750 11:35681676-35681698 GCTGTCTTTTCTTACTATCCTGG + Intronic
1084324268 11:68390560-68390582 GATGTCTGTTCTCCCTTTGCTGG + Intronic
1088539744 11:110901411-110901433 GCTGACTCCTCTCACCCTGCTGG + Intergenic
1088660490 11:112040949-112040971 TCCCACTGTTCTTACTATGCAGG + Intronic
1091605484 12:1948229-1948251 GCTGAATGTTCTCCCGAGGCTGG + Intronic
1099170082 12:79353558-79353580 GCTGACTGTTGTCATTCTGGAGG + Exonic
1104877463 12:132045630-132045652 GCTCACTGTGATCACTTTGCAGG + Intronic
1107130084 13:36885942-36885964 GCTGACTGTTCTCACTATGCGGG + Intronic
1111815656 13:93149461-93149483 ACTGAATGTTCTCATTATGATGG + Intergenic
1114346785 14:21804727-21804749 GCTGACTGTTCATTGTATGCTGG - Intergenic
1118704584 14:68468982-68469004 GCTGACTCTTCTAACAGTGCTGG - Intronic
1122466702 14:101938615-101938637 GCTGACTGTTTTCAACCTGCAGG + Intergenic
1123696440 15:22882235-22882257 GCTGGCAGTGCTCACGATGCTGG - Intronic
1127712412 15:61612995-61613017 GCTCACTTTTCTCACTGTGTTGG - Intergenic
1128802548 15:70505863-70505885 GCTGACTAATAGCACTATGCGGG + Intergenic
1129661400 15:77554912-77554934 GCTGAGTGTTCCCAGGATGCTGG + Intergenic
1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG + Intronic
1133879104 16:9763928-9763950 GCTCGCTGGTCTCACTGTGCGGG + Exonic
1138887625 16:61098661-61098683 GTTGCCTGTTCTCAATATCCTGG + Intergenic
1141000998 16:80307744-80307766 GGTGACTTTTCTCGCTCTGCAGG - Intergenic
1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG + Intergenic
1142485762 17:246902-246924 GGTGACTGTTCGCTCTGTGCAGG - Intronic
1145884692 17:28373749-28373771 GCTGGCTGTACTCACTCTCCAGG - Intronic
1146322455 17:31857756-31857778 GGTGACTGTTCTGACCCTGCAGG + Intronic
1154098256 18:11441344-11441366 GCTGTTTTTTCTCACCATGCTGG + Intergenic
1158547284 18:58406930-58406952 GCTGTCTTTTCCCACTGTGCTGG - Intergenic
1159808359 18:72983441-72983463 GCTGACAGTCCTGACTATTCTGG + Intergenic
1160412250 18:78683112-78683134 TCTGACAGTTTTCACTTTGCAGG - Intergenic
1160892422 19:1386281-1386303 GCTGATTGTTCTCACAGTTCTGG + Intronic
1161496245 19:4587485-4587507 GCTGGGTGTGCTCACTAGGCTGG - Intergenic
1163026384 19:14515228-14515250 GCTGAATGTCCTCACTTTGTGGG - Exonic
1163310199 19:16509722-16509744 GCTGACTGTGTTCACCATGGGGG - Exonic
1165766396 19:38354056-38354078 GCTGACAGTTCTCACTGAGATGG - Intronic
927285041 2:21348367-21348389 GTTAACTGTTCTCACTGTGGGGG + Intergenic
935783886 2:106531730-106531752 GCTGGCTGTTCTCACTGGACTGG - Intergenic
941579358 2:167275194-167275216 GCTGCCTCTTCTCCCTCTGCAGG + Intergenic
943786065 2:191880453-191880475 GCTGAATGTCCTCACTTTGTGGG - Intergenic
948760638 2:240188396-240188418 GCTGCCCGTTCTCACAGTGCAGG - Intergenic
948935756 2:241163380-241163402 CCTGACAGTCCTCAGTATGCAGG + Exonic
1175553144 20:59829739-59829761 GCTGTCTGTTCTCTCTAGGAAGG + Intronic
1177334063 21:19700935-19700957 GGTGGCTGTCCTCAATATGCAGG - Intergenic
1177944192 21:27446730-27446752 GCAGACTATTCTCCCTATGGTGG - Intergenic
1181802482 22:25356679-25356701 TCTGTCTCTTCTCCCTATGCTGG - Intronic
1183878173 22:40802282-40802304 GCTGACTGTTCTCTTTATCTTGG - Intronic
949438801 3:4058002-4058024 AGTGAGTGTTCTCTCTATGCTGG + Intronic
952910397 3:38179717-38179739 GCTGACTTTTCACACAATGAGGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955275753 3:57545582-57545604 GCTGACTCCTTTCACTATGATGG - Intergenic
957685039 3:83492395-83492417 GCTGACTTTTCTGACTAATCTGG - Intergenic
961597098 3:128026595-128026617 CCTGATTGTTTTCACTATGTTGG + Intergenic
962399020 3:135041168-135041190 GCTGAAAGTTCTCAGTATGTTGG - Intronic
963801655 3:149682293-149682315 GATGACAGTTTTCACTATCCTGG - Intronic
964503144 3:157370233-157370255 GCTCGCTGCTCTCACTAAGCGGG + Intronic
965137649 3:164793158-164793180 GCTGAATGTACTCATTATCCAGG + Intergenic
972976911 4:44646702-44646724 GGTGACTGTGCTCACTAAGACGG - Intronic
974500962 4:62702140-62702162 GCTGATTATTCCCACTAAGCAGG + Intergenic
980784024 4:137529691-137529713 GGTGACTGTTGTGACTCTGCCGG + Exonic
987211441 5:15687677-15687699 CCTCACTGTCCTCACTGTGCAGG - Intronic
987517509 5:18932279-18932301 GCTGACTGTTCTCTTCATTCAGG + Intergenic
988040887 5:25887948-25887970 TCTGTCTGTTCTGGCTATGCAGG + Intergenic
988071466 5:26294060-26294082 TCTGATTGTTCTCTTTATGCAGG + Intergenic
988422826 5:31026992-31027014 GCTTACTATTCTCACAATTCTGG - Intergenic
989421280 5:41241859-41241881 GCTGTCTTTTCACACTGTGCTGG - Intronic
990974667 5:61548887-61548909 GCTGGCTGTTCTGACTAGGCTGG - Intergenic
993759545 5:91775753-91775775 GCTTCATGTTGTCACTATGCTGG - Intergenic
994502900 5:100602485-100602507 GGTTACTGTGCTCACTATGTGGG + Intergenic
994568762 5:101485993-101486015 GCTTCCTGTTCTCACAATTCTGG + Intergenic
1000297501 5:159924914-159924936 GCTTACTGTGCTCTCCATGCTGG + Intronic
1003213327 6:4087526-4087548 GCTGGCTGTTCTCGTGATGCTGG - Exonic
1005300195 6:24462963-24462985 GCTGACGGTTGTCACTATCATGG + Intronic
1006003195 6:30982784-30982806 GCTGACTGTTTCCCCTCTGCTGG + Intergenic
1007337989 6:41168509-41168531 GGTGACTGTTCTCTCTACCCTGG + Intergenic
1007497200 6:42268372-42268394 GCTGACTGTCCTCACGCTGCTGG + Exonic
1017109667 6:150920351-150920373 GCTGAGTGTTCTCATGGTGCTGG + Intronic
1018022989 6:159779880-159779902 AATGACTGTTCTTACCATGCTGG + Exonic
1018630645 6:165819210-165819232 GCTGACTGGGCTCAGGATGCTGG - Intronic
1020384623 7:7585614-7585636 GCTGGCTGTTTTTAATATGCAGG + Exonic
1021316900 7:19158783-19158805 CCTAACTGTTCTCAGTATGAGGG + Intergenic
1024337459 7:48224098-48224120 GCTGTCTGTTCCCACCCTGCTGG + Intronic
1027891683 7:83985753-83985775 TCTCACTGTGCTCACTGTGCAGG - Intronic
1034330807 7:150280581-150280603 CCTAACTGTACTCACCATGCTGG - Intronic
1034667236 7:152829268-152829290 CCTAACTGTACTCACCATGCTGG + Intronic
1037149709 8:15621848-15621870 TCTGAATGTTCTCTCTCTGCAGG + Intronic
1039582156 8:38675562-38675584 GCTATCTCTTCTCACTATGCAGG - Intergenic
1043674832 8:82937614-82937636 GCTGCATGCTCTAACTATGCAGG - Intergenic
1049835954 8:144735687-144735709 TCTGGCTGTTGTCACTATGGTGG - Intronic
1061033879 9:128102787-128102809 GCTGTCTGTTCTCCCAAAGCTGG + Intronic
1187719322 X:22134868-22134890 GGTGATTGTTATCACTAGGCAGG + Intronic
1189381124 X:40503052-40503074 GCTCACTGTTGTCACTGTCCAGG + Intergenic
1192124297 X:68487399-68487421 GCTGACTGGTCTCACTTTAAGGG - Intergenic
1192127102 X:68511834-68511856 CCTGACTCTTCTCAGTTTGCAGG + Exonic
1201690493 Y:16759468-16759490 GAAGATTGTTCTCACTTTGCAGG + Intergenic