ID: 1107133469

View in Genome Browser
Species Human (GRCh38)
Location 13:36920157-36920179
Sequence GGCGGCGGGGACCGAGACAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107133458_1107133469 2 Left 1107133458 13:36920132-36920154 CCCAGCGCCTGCAGGGCCCGGCG 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1107133469 13:36920157-36920179 GGCGGCGGGGACCGAGACAGCGG 0: 1
1: 0
2: 3
3: 29
4: 252
1107133453_1107133469 30 Left 1107133453 13:36920104-36920126 CCGCGCACTCACTGCCTGGCTGC 0: 1
1: 0
2: 4
3: 27
4: 246
Right 1107133469 13:36920157-36920179 GGCGGCGGGGACCGAGACAGCGG 0: 1
1: 0
2: 3
3: 29
4: 252
1107133462_1107133469 -5 Left 1107133462 13:36920139-36920161 CCTGCAGGGCCCGGCGGCGGCGG 0: 1
1: 0
2: 10
3: 86
4: 502
Right 1107133469 13:36920157-36920179 GGCGGCGGGGACCGAGACAGCGG 0: 1
1: 0
2: 3
3: 29
4: 252
1107133459_1107133469 1 Left 1107133459 13:36920133-36920155 CCAGCGCCTGCAGGGCCCGGCGG 0: 1
1: 0
2: 3
3: 42
4: 528
Right 1107133469 13:36920157-36920179 GGCGGCGGGGACCGAGACAGCGG 0: 1
1: 0
2: 3
3: 29
4: 252
1107133454_1107133469 16 Left 1107133454 13:36920118-36920140 CCTGGCTGCGCGCGCCCAGCGCC 0: 1
1: 0
2: 2
3: 33
4: 341
Right 1107133469 13:36920157-36920179 GGCGGCGGGGACCGAGACAGCGG 0: 1
1: 0
2: 3
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107133469 Original CRISPR GGCGGCGGGGACCGAGACAG CGG Exonic