ID: 1107140451

View in Genome Browser
Species Human (GRCh38)
Location 13:36993012-36993034
Sequence GAAGATGCACAGCCTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107140446_1107140451 1 Left 1107140446 13:36992988-36993010 CCACCAAAAAAGTGCTCCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 267
1107140448_1107140451 -2 Left 1107140448 13:36992991-36993013 CCAAAAAAGTGCTCCTCAGGAGA 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 267
1107140445_1107140451 19 Left 1107140445 13:36992970-36992992 CCACTCACAGGTCAAGGGCCACC 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107140451 Original CRISPR GAAGATGCACAGCCTCAGCT GGG Intronic
900405454 1:2490965-2490987 GAAGCCGCACAGGCTCTGCTGGG + Intronic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
905516167 1:38563583-38563605 GAAGGGGCACAGCCCCAGATAGG + Intergenic
907483205 1:54758789-54758811 CAACATGCCCAGCCTCAGCCCGG - Exonic
907733174 1:57087296-57087318 GGAGATGCAGAGCCTGGGCTGGG + Intronic
907848468 1:58230994-58231016 GAAGATGCATAGCCACAGTGTGG - Intronic
908489809 1:64632151-64632173 AAATATGCACAACCTCTGCTTGG - Intronic
910339390 1:86168285-86168307 GATGAGGCACCGCCTCATCTGGG - Intergenic
911091067 1:94017356-94017378 CAAGATGCACACCCTCAACCTGG + Intronic
912879156 1:113391054-113391076 GAAGAAGCACTGGCTCAGCAAGG + Exonic
916371130 1:164095711-164095733 GAAGATGTTCAGCATCAGCTGGG + Intergenic
919688599 1:200507852-200507874 GAAGATGGACAGCCTGGGCCAGG - Intergenic
921691522 1:218156716-218156738 GAAGAATCACAGCCTCAGCAAGG - Intergenic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922378106 1:224990425-224990447 AAAGATACAAAGCCTCAGATGGG - Intronic
922476516 1:225910531-225910553 GGAGATGCTGACCCTCAGCTGGG - Intronic
922730392 1:227946366-227946388 CAAGAAGCAGAGCCTCCGCTGGG + Intronic
922766130 1:228157542-228157564 GCAGATGCAGGGCCCCAGCTGGG - Intronic
923462844 1:234222177-234222199 GAAGATGCACAGCTTCTCTTTGG - Intronic
924402743 1:243704668-243704690 GATGATGCAGTGCCTCATCTTGG - Intronic
1062803202 10:395182-395204 GAAGAGACAAAGCCTCAGATTGG + Intronic
1064014425 10:11761565-11761587 GAAGGTTGGCAGCCTCAGCTGGG + Intronic
1064215536 10:13397293-13397315 GAAGATGTGGAGCCTCAGCCAGG + Intergenic
1064563257 10:16613483-16613505 AAAGATGCCCAGGCTCAGATGGG - Intronic
1066704337 10:38161426-38161448 TAAGAAGCAAATCCTCAGCTGGG - Intergenic
1067054805 10:43044319-43044341 GGAGAAGCACAGTCTCAGCTGGG + Intergenic
1067180410 10:43981275-43981297 GAAGAGGAACTGCCACAGCTGGG - Intergenic
1067439380 10:46300076-46300098 GAAGACTCACATCCTCACCTGGG - Intronic
1069862310 10:71479447-71479469 GCAGATGGACAGGCTCACCTTGG - Intronic
1071594952 10:86914619-86914641 AAAGATGCTCAGCATCAGCAGGG + Intronic
1071900829 10:90119008-90119030 GGAGAGGCACTGCCTCACCTGGG - Intergenic
1074216503 10:111389962-111389984 AAACATGCACTGCCTCAGTTGGG + Intergenic
1075461700 10:122620744-122620766 GAAGCTGCACAGCTCCAGATAGG - Intronic
1075624047 10:123948843-123948865 TAAGATGCAGATCCCCAGCTTGG + Intergenic
1075698801 10:124455129-124455151 GGAGATGCAGAGACTCAGCAGGG + Intergenic
1075980561 10:126735271-126735293 GAACAAGCACAGGCTCAGCCAGG + Intergenic
1076191082 10:128483880-128483902 GAAGTTACACAGCCCCAGGTGGG + Intergenic
1076422077 10:130338829-130338851 GAAGATGCGGTGCCCCAGCTGGG + Intergenic
1076451798 10:130561429-130561451 GAAGATGCACACCCTGAGAATGG - Intergenic
1076806927 10:132863349-132863371 GAAGAGGGCCAGCCTCTGCTGGG - Intronic
1077341314 11:2027635-2027657 GAGAATGCACAGGCTCAGCCCGG + Intergenic
1077699627 11:4429599-4429621 CAAGATGCAAAGTATCAGCTGGG - Intergenic
1078745184 11:14106867-14106889 GAATATGCACAGACTCAGGAAGG - Intronic
1078846972 11:15127145-15127167 GGAGATTAACAGCCTCAGATAGG + Intronic
1078975385 11:16468842-16468864 AAAAATACACAGCCTGAGCTAGG - Intronic
1081680484 11:44999031-44999053 GAGGATGCAAAGCCTCAGTCAGG - Intergenic
1082741809 11:56919051-56919073 GGAGATCCACAGCCTCATCCTGG - Intergenic
1084027650 11:66462349-66462371 GAAAATTCCCAGCCTCAGCCAGG + Intronic
1085551205 11:77374242-77374264 GTAGAGGCAGAGCCTGAGCTGGG - Intronic
1088810388 11:113387901-113387923 GAGGCTGCCCAGCCGCAGCTCGG - Exonic
1089151336 11:116366711-116366733 GAAGAAGGAAAGCCTCTGCTGGG - Intergenic
1089830045 11:121319401-121319423 GAAACTGCTCAGCCTCAGCCAGG - Intergenic
1090334488 11:125953574-125953596 GTAGATGCCCAGGCGCAGCTGGG - Intergenic
1202824299 11_KI270721v1_random:82824-82846 GAGAATGCACAGGCTCAGCCCGG + Intergenic
1094502844 12:31036145-31036167 GAAGATGCACTGCTGCTGCTGGG - Intergenic
1095462697 12:42459345-42459367 TAAGATGCACAGTGTTAGCTAGG + Exonic
1096555611 12:52401726-52401748 GAGGATGCACAGGGTCAGCCGGG - Intronic
1102131483 12:110532997-110533019 GAAGGTGCAAAGCCTCAGCTGGG + Intergenic
1102535249 12:113576231-113576253 GAAGGTGAACAGCCTCAGAGAGG - Intergenic
1102543037 12:113636083-113636105 GAAGATGCTTAACCTCATCTGGG - Intergenic
1104778315 12:131404149-131404171 GCAGATGCAAAGCCCCAGCCAGG + Intergenic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1106169100 13:27273356-27273378 CAAGATGCACGGCCTCAGTGGGG + Exonic
1106170476 13:27284108-27284130 CAAGGTCCCCAGCCTCAGCTGGG + Intergenic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107793548 13:44026943-44026965 GATGATGCTCAGCATCACCTGGG + Intergenic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1110732432 13:78894571-78894593 AAAGATGCTCAACATCAGCTGGG - Intergenic
1113778848 13:112964124-112964146 GGCTATGCACAGCCCCAGCTGGG - Intronic
1113937463 13:114001956-114001978 GAGGATGCAAGGCCTCAGCGAGG + Intronic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1122014919 14:98787100-98787122 GAAAACTCACAGCCTCAGCAGGG - Intergenic
1122710983 14:103657984-103658006 GAAGCTCCAGAGCCTAAGCTGGG - Intronic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1125639278 15:41216334-41216356 GAAAATTCAGAGCCTCGGCTGGG + Intronic
1126779981 15:52131119-52131141 TAAAATGCACACACTCAGCTGGG - Intronic
1126983030 15:54268299-54268321 GAAGATGCAAAGACCCAGTTAGG - Intronic
1127639057 15:60898159-60898181 AAAGAAGCAGAGGCTCAGCTTGG + Intronic
1127752552 15:62060279-62060301 CCAGATGCCCAGCTTCAGCTGGG + Exonic
1128145838 15:65332083-65332105 GATGCTGCACAAACTCAGCTGGG + Exonic
1128643750 15:69359967-69359989 GAAGCGGCACAGCACCAGCTAGG + Exonic
1129045129 15:72727137-72727159 GAAGATGCAAAGCCCCAGCCAGG - Intronic
1131989560 15:98080197-98080219 CAAGATGCAGAGGCTCAGATGGG + Intergenic
1132816662 16:1832143-1832165 CATGATGCCCAGCCTTAGCTGGG - Intronic
1133756494 16:8766307-8766329 GAAGCTGCACAGCCTCTCCCGGG + Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1136379840 16:29888116-29888138 TAAAATTCAAAGCCTCAGCTGGG + Intronic
1136923113 16:34347146-34347168 GGAGAGGCACAGCCTCTGCCTGG - Intergenic
1136931494 16:34421842-34421864 GAAGATGTGGAGCCTCAGCCAGG - Intergenic
1136973078 16:34989977-34989999 GAAGATGTGGAGCCTCAGCCAGG + Intergenic
1136981460 16:35064660-35064682 GGAGAGGCACAGCCTCTGCCTGG + Intergenic
1139546695 16:67653066-67653088 GAAGATGCAGAGCCGCAGGCGGG + Exonic
1139970115 16:70769109-70769131 AAAAATGCACATCCACAGCTGGG - Intronic
1140787178 16:78353810-78353832 CAAGTTGCACAGCCTGGGCTTGG + Intronic
1141552490 16:84815533-84815555 GGTGAGGCACAGCCTGAGCTGGG + Intergenic
1142993020 17:3744406-3744428 GAAGAGTCACAGCCACACCTGGG + Intronic
1143314910 17:6025222-6025244 GAAGAGACACAGCTTCAGCTTGG - Intronic
1146832919 17:36085374-36085396 GAAAGTGCACATCCCCAGCTGGG + Intergenic
1148624163 17:49056182-49056204 TGAGATGCTCAGCCTCAGCATGG + Intergenic
1150655024 17:67033682-67033704 GAAGATACACAGGCTCTTCTGGG + Intergenic
1150767015 17:68010338-68010360 TTAAATGGACAGCCTCAGCTGGG + Intergenic
1151340297 17:73466725-73466747 AAAGATGCAGAGCCTAAGCCGGG - Intronic
1151381390 17:73728128-73728150 TTAGATGCACAGCACCAGCTGGG - Intergenic
1203164386 17_GL000205v2_random:80397-80419 GAAGATTCACATCATCAACTTGG + Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155473731 18:26217047-26217069 CAAAATGCATAACCTCAGCTGGG + Intergenic
1155540332 18:26863187-26863209 GAACAGGCAGGGCCTCAGCTGGG + Intronic
1157800856 18:50619878-50619900 GAGGAGGCACAGCCTCATGTGGG + Intronic
1158271578 18:55722048-55722070 GAAAATGCTCAAACTCAGCTGGG - Intergenic
1158534911 18:58299315-58299337 AAAGATGCAAAGACTGAGCTTGG + Intronic
1158554821 18:58466448-58466470 GAAGAGGCCCAGGCTCAGCATGG - Intergenic
1160152141 18:76403415-76403437 GTACATGCACAGCCACACCTGGG + Intronic
1160584069 18:79903173-79903195 GCATGTGCACAGCCTCAGCCCGG + Exonic
1162788826 19:13052710-13052732 ACAGAAGCACAGCCTCAACTGGG - Intronic
1163856193 19:19704191-19704213 TAAAATACACAGCCACAGCTAGG + Intergenic
1164398667 19:27887994-27888016 GATGCTGCTCAGCCTCAGCAGGG + Intergenic
1165947572 19:39453546-39453568 GTAGAAGCTCAGCCTCTGCTCGG - Intronic
1166529203 19:43532709-43532731 GAAGGTGCACCGCCACTGCTCGG + Intronic
1166739805 19:45107109-45107131 AAAGATGCTCAACATCAGCTGGG - Intronic
1166965702 19:46528394-46528416 GATGAGGCTCAGTCTCAGCTGGG - Intronic
1167179902 19:47894965-47894987 CAACATGCCCAGCCACAGCTGGG - Intergenic
1167617256 19:50542253-50542275 GAAGGTGCACCACCTCGGCTGGG - Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925338082 2:3113307-3113329 GAAGGTTCAGAGCTTCAGCTGGG + Intergenic
926729277 2:16023166-16023188 GAATACACACAGCCTCAGCTGGG - Intergenic
927954538 2:27199389-27199411 GAAGATGCACACCCTCTCCTAGG - Intergenic
929800449 2:45095902-45095924 GTATACCCACAGCCTCAGCTAGG - Intergenic
932219188 2:69986999-69987021 GAAGGTGCACATCCTCTGCAGGG - Intergenic
933938780 2:87228241-87228263 TAAGAAGGGCAGCCTCAGCTTGG - Intergenic
933998385 2:87686486-87686508 GCAGGTGGACAGCCCCAGCTGGG - Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
935364944 2:102279331-102279353 CAACATGCACTGCCTTAGCTGGG - Intergenic
936087974 2:109482455-109482477 GAAGATAAACAGCCACAGCACGG - Intronic
936295464 2:111264387-111264409 GCAGGTGGACAGCCCCAGCTGGG + Intergenic
936354356 2:111737534-111737556 TAAGAAGGGCAGCCTCAGCTTGG + Intergenic
937028088 2:118715674-118715696 GAAAATCCACAGCCTCAGATGGG + Intergenic
937333135 2:121044501-121044523 GTAGCTGACCAGCCTCAGCTAGG + Intergenic
939963917 2:148592199-148592221 CAATATGCACAGTCCCAGCTAGG + Intergenic
943366605 2:186972765-186972787 GAATATTCACGGCCCCAGCTTGG + Intergenic
943427113 2:187750469-187750491 CCAGATCCACAGCCTCAGCTGGG + Intergenic
944022793 2:195126056-195126078 CAAGGTCCGCAGCCTCAGCTGGG + Intergenic
944364707 2:198904312-198904334 GAAGATGAAAACCCTCAGCTTGG - Intergenic
946028636 2:216687895-216687917 GAAGGTGCCCAGGCTCTGCTAGG + Intronic
948669036 2:239554902-239554924 GAACAGGCACAGCCTGTGCTTGG + Intergenic
1169650843 20:7865493-7865515 GGAAATGCCCAGCCTCAGCTGGG - Intergenic
1172502094 20:35434611-35434633 GCAGCTGGACAGCTTCAGCTGGG + Exonic
1172679534 20:36701841-36701863 AAAGATGCAGGGTCTCAGCTGGG - Intronic
1173344234 20:42184144-42184166 GAAAATGGGGAGCCTCAGCTGGG - Intronic
1173502133 20:43561680-43561702 TAAAATCCAAAGCCTCAGCTGGG - Intronic
1173849891 20:46211134-46211156 TAAGAAGCACAGGCTCAGCATGG - Intronic
1174124827 20:48296751-48296773 CAAGATGCACAGACTCACGTGGG - Intergenic
1175506070 20:59485220-59485242 GAAGAAGCACAGCAGCTGCTCGG + Intergenic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1176973371 21:15290553-15290575 CAAGGTCCACAGCCACAGCTTGG + Intergenic
1179622313 21:42625373-42625395 GGAGATGCACAGGCTAATCTAGG + Intergenic
1184551030 22:45204228-45204250 GAAGACGCACACCCTCATCACGG + Intronic
1184941028 22:47765477-47765499 GAAGATGCCCACCCTGTGCTTGG + Intergenic
950313982 3:11984172-11984194 GAAAATGCAGATGCTCAGCTAGG - Intergenic
950728860 3:14938970-14938992 GAACATGCACATCCTCTTCTTGG - Intergenic
953545408 3:43860651-43860673 GAAACTGCACAGCCTCAGAGGGG - Intergenic
954075547 3:48176604-48176626 GAAAATACCCAGCCTCAGGTAGG + Intronic
954198930 3:49012842-49012864 GAAGGTGCACAGCTTGAGCTGGG + Exonic
954688130 3:52381692-52381714 GAAGAGGACCAGCTTCAGCTTGG - Exonic
955158958 3:56446066-56446088 GAGGAGGGACAGCCTCAGTTGGG - Intronic
956591883 3:70924007-70924029 CAAGAAGCACAGTCTCAGTTGGG + Intergenic
956771248 3:72527822-72527844 GAGGATGTGCAGCCTCACCTGGG + Intergenic
958578731 3:95988786-95988808 GATGAGGCATAGCCTCACCTGGG - Intergenic
960402433 3:117218115-117218137 GCAGATGCACTGTCTGAGCTGGG + Intergenic
961207445 3:125096262-125096284 GAAGATGCACTGTTTCAGGTAGG - Intronic
964753001 3:160069287-160069309 GAATATTCACGGCCCCAGCTTGG + Intergenic
966428006 3:179801433-179801455 GAAAAAGCACTGCCTCAGATTGG - Exonic
967174861 3:186853809-186853831 GAGGAGGCAGAGCTTCAGCTAGG + Intronic
968272999 3:197419052-197419074 GCACAGGCACAGGCTCAGCTTGG + Intergenic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
972305138 4:37823623-37823645 GAGGCTGCACAGACTCATCTGGG + Intergenic
973157957 4:46981124-46981146 TAAAGTGAACAGCCTCAGCTAGG - Intronic
973164958 4:47065384-47065406 GAAATTGCACAGCCTCAACAAGG - Intronic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
981990997 4:150920975-150920997 GAAAATGCCCAGTCACAGCTTGG - Intronic
985423871 4:189810510-189810532 GAACACGCCCAGCCTCAGCCTGG - Intergenic
985423890 4:189810587-189810609 GAACACGCCCGGCCTCAGCTCGG - Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
987418636 5:17692137-17692159 GAAGATGGTGAGCCCCAGCTTGG + Intergenic
989582579 5:43046764-43046786 GTAGATGCACAGCCTCACTTAGG + Intergenic
993063759 5:83073823-83073845 GATGAAGCACAGCTCCAGCTTGG - Intronic
994074826 5:95639027-95639049 GATTCTGCATAGCCTCAGCTGGG + Intergenic
997378929 5:133421353-133421375 GCAAATGTAGAGCCTCAGCTAGG - Intronic
998888534 5:146721074-146721096 AAAGAACCACAGCCTCACCTGGG + Intronic
1001066355 5:168537883-168537905 GAAGATGCAGAGCATGAGCAGGG + Intergenic
1002775175 6:322461-322483 GAAGCTGCAAAATCTCAGCTTGG - Intronic
1004206034 6:13592465-13592487 GCAGAAGCACAGCCTCAGTGGGG - Intronic
1004206054 6:13592567-13592589 GCAGAAGCACAGCCTCAGTGGGG - Intronic
1004489394 6:16099956-16099978 GAAGATGGAGAAGCTCAGCTAGG - Intergenic
1006406617 6:33849283-33849305 ATGGATGCACAGCCCCAGCTTGG - Intergenic
1007410455 6:41658361-41658383 AAAGATGGACAGCCACAGCAGGG + Intergenic
1011499534 6:87972744-87972766 GAGCATGCTCAGCCTGAGCTGGG + Intergenic
1015194591 6:130511086-130511108 GAAATTACACAGTCTCAGCTGGG + Intergenic
1015378518 6:132538307-132538329 ACAGCTCCACAGCCTCAGCTTGG - Exonic
1015427123 6:133083791-133083813 CAAGCTGCACAGCTTCTGCTTGG - Intergenic
1018003015 6:159596618-159596640 GAAAATGCAGAGCCCCAGTTGGG + Intergenic
1019214684 6:170435501-170435523 GGAGATTCACAGCCTTGGCTGGG + Intergenic
1019266388 7:119643-119665 GAAGCTGTACAGCCCCAGCACGG + Intergenic
1022190835 7:28015759-28015781 AAGGATCCACAGCCTCTGCTGGG - Intronic
1022276618 7:28861619-28861641 GAAAATGGTCAGCCACAGCTCGG - Intergenic
1022550641 7:31236136-31236158 GAAGAAGCATAGCCTAGGCTGGG + Intergenic
1023902573 7:44494351-44494373 GTAGTGGCACAGTCTCAGCTCGG + Intergenic
1024917942 7:54524873-54524895 GAAGAAGGAAAGCCACAGCTGGG - Intergenic
1027578178 7:79957641-79957663 CAATATGCACAGCATCAGGTAGG - Intergenic
1027924737 7:84446939-84446961 GCAGCTGCCCAGCCACAGCTGGG + Intronic
1031133816 7:117863544-117863566 GCAGATTCACAGCCCCACCTCGG - Intronic
1032554395 7:132816654-132816676 GAGGAGGCACAGCAGCAGCTGGG - Intronic
1034327181 7:150247351-150247373 GAACATGCACATCTTCACCTGGG + Exonic
1034766029 7:153722106-153722128 GAACATGCACATCTTCACCTGGG - Intergenic
1034816773 7:154178823-154178845 GAGGAGGAACAGCCTCAGATGGG + Intronic
1035434681 7:158850386-158850408 AAAGATCCACAGCCACAGTTTGG + Intergenic
1036759088 8:11494587-11494609 GAAGACGCAGGGCCTCACCTTGG - Exonic
1037879702 8:22566634-22566656 GGAGAAGCACAACCTCAGCTTGG - Intronic
1037946939 8:22995680-22995702 CAAGATGCAGAGCCCCAGCAGGG - Intronic
1038796533 8:30715352-30715374 GAAGTAGCATATCCTCAGCTTGG - Intronic
1042153707 8:65818745-65818767 GCACATGCACAGCCTCATCCAGG + Intronic
1045314903 8:101035132-101035154 GAAGATGCTCAGGCTCACCAAGG - Intergenic
1046802398 8:118442930-118442952 GAGGACGCTCAGCCTCAGCTGGG + Intronic
1048162946 8:132037703-132037725 GAGGGAGCACAGCCACAGCTGGG + Intronic
1048838442 8:138543815-138543837 GAGGATGTACAGCCTGAGTTTGG - Intergenic
1049247823 8:141572069-141572091 GGAGCTGCTCAGCCTCAGCGAGG + Intergenic
1050177619 9:2884374-2884396 GAAGATACGAAGCCCCAGCTGGG - Intergenic
1050262361 9:3854081-3854103 GTAGATGCACAGCCTGAGTGTGG - Intronic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056942725 9:90969123-90969145 CAAGAGGCTCAGCCTAAGCTAGG - Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057226277 9:93294908-93294930 GAAGATTTTCAGCCTCAACTGGG + Intronic
1057441341 9:95085977-95085999 GGAGAAGCAGCGCCTCAGCTGGG - Intronic
1057593267 9:96392347-96392369 GAAGATGCACAGCGCGGGCTGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1058970803 9:110081120-110081142 GAAGAGGCACTGCTTCAGCCTGG + Intronic
1059058635 9:111011952-111011974 AAAAATGCAGAGTCTCAGCTAGG + Intronic
1060887677 9:127167168-127167190 GAAAATCCACAGCCTCCGTTTGG + Intronic
1061826223 9:133259955-133259977 GAAGGGGCACAGCGTCAGCCTGG + Intronic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185738833 X:2513977-2513999 TCAGAAGCAGAGCCTCAGCTGGG + Intergenic
1185829538 X:3286996-3287018 GAAGCTGCATTGCCTCAGTTGGG + Intergenic
1187447917 X:19374155-19374177 GAAGACGCAGAACCCCAGCTGGG + Intronic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190495599 X:51025740-51025762 GGAGAAGCACAGCATCAGCCCGG + Intergenic
1190510327 X:51167841-51167863 GGAGAAGCACAGCATCAGCCCGG - Intergenic
1191670034 X:63740472-63740494 GATGATGGAAAGGCTCAGCTAGG - Intronic
1192419837 X:71019902-71019924 GAAAATGAACAGCCTCAGCTGGG - Intergenic
1194047911 X:89032651-89032673 AAACATGCAGAGCCTAAGCTAGG - Intergenic
1195422868 X:104694991-104695013 GATAATGTCCAGCCTCAGCTGGG + Intronic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1200232084 X:154449110-154449132 GACGCTGCAGAGCCTCAGCCAGG - Intronic
1201248469 Y:12030959-12030981 GAAGCTGCATTGCCTCAGTTTGG - Intergenic
1202253023 Y:22892530-22892552 GAAGAGTCACAGTCTCAGCCTGG + Intergenic
1202406013 Y:24526279-24526301 GAAGAGTCACAGTCTCAGCCTGG + Intergenic
1202464767 Y:25143802-25143824 GAAGAGTCACAGTCTCAGCCTGG - Intergenic