ID: 1107141062

View in Genome Browser
Species Human (GRCh38)
Location 13:36999166-36999188
Sequence CCTGGAGACTGCGGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141062_1107141069 4 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1107141062_1107141066 -6 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141066 13:36999183-36999205 TCCAGGAGAGCGGTAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1107141062_1107141068 3 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141062 Original CRISPR CCTGGAGACTGCGGCTCCTC AGG (reversed) Intronic
901376968 1:8846492-8846514 GGTGGGGACTGGGGCTCCTCAGG - Intergenic
903541288 1:24097760-24097782 CCTGGAGACTCCCGCTTCCCTGG - Intronic
903848250 1:26291065-26291087 CCTGGAGCCTGGGACTCCTAGGG - Intronic
907909593 1:58814773-58814795 CCTGGCCCCTGCGCCTCCTCCGG + Intergenic
910803043 1:91164419-91164441 CCTGGGTCCTGCAGCTCCTCTGG - Intergenic
910851282 1:91651772-91651794 CATGGAGCCTGGGCCTCCTCTGG + Intergenic
913960262 1:143333850-143333872 GCTGGGCACTGCGGGTCCTCGGG - Intergenic
914054618 1:144159423-144159445 GCTGGGCACTGCGGGTCCTCGGG - Intergenic
914124528 1:144806938-144806960 GCTGGGCACTGCGGGTCCTCGGG + Intergenic
915070364 1:153261220-153261242 TCCGGAGGCGGCGGCTCCTCCGG + Exonic
917034373 1:170730751-170730773 CCTGGCTTCTGCTGCTCCTCAGG + Intronic
919419731 1:197355458-197355480 CCTGGAAGCTGGGGCTGCTCAGG + Intronic
923902231 1:238338872-238338894 CCTGTAGTCTGCAGCTACTCAGG - Intergenic
1062971674 10:1653508-1653530 GGTGGAGACTGCGGCTCTGCAGG - Intronic
1063313967 10:4983885-4983907 CCTGGAGAGTGCTTCTCCTGTGG + Intronic
1063653892 10:7967786-7967808 CCTGGAGATTGCTGCTCCATTGG + Intronic
1068633220 10:59320005-59320027 CCTGGCAACTGCTGCTCCTGGGG - Intronic
1069942276 10:71964137-71964159 CCTGGAGACAGCGGCTCCCCGGG + Intergenic
1074290860 10:112137224-112137246 CCTGGAGCCTCCGGTTCCTATGG - Intergenic
1074601122 10:114914216-114914238 CCTGCAGACAGCTGGTCCTCAGG + Intergenic
1076626243 10:131823424-131823446 TCTGGAGCCTGCGTCTCCTGTGG - Intergenic
1076626289 10:131823595-131823617 TCTGGAGCCTGCGTCTCCTGTGG - Intergenic
1076626413 10:131824061-131824083 TCTGGAGCCTGCGTCTCCTGTGG - Intergenic
1076626447 10:131824189-131824211 TCTGGAGCCTGCGTCTCCTGTGG - Intergenic
1076626467 10:131824274-131824296 TCTGGAGCCTGCGTCTCCTGTGG - Intergenic
1078844125 11:15106633-15106655 CCTGGAGAGTGCAGCAGCTCTGG - Intergenic
1079450531 11:20597157-20597179 CGTGGAGACTGCCGCGCGTCAGG - Intergenic
1080669084 11:34359178-34359200 CCTTGAGCCTGCGGTTCCACTGG - Intergenic
1083737214 11:64688254-64688276 TCTGGAGCCTGCGCCTCCACGGG + Intronic
1084408100 11:68990445-68990467 CCTGGAGCCTGTGTCTCATCTGG + Intergenic
1084435196 11:69135375-69135397 CCTGGACAGTGGGTCTCCTCCGG + Intergenic
1085533659 11:77205789-77205811 GCTGGAGAGTCCGGCTGCTCGGG + Intronic
1087003929 11:93450260-93450282 CCAGGAGGCTGGGGCTCCTAAGG - Intergenic
1091773892 12:3171886-3171908 CCTGGGGACTGCGGCCACTCTGG - Intronic
1097261699 12:57724156-57724178 CATGGAGGCTGCGGCTCTACAGG - Intronic
1097553140 12:61100590-61100612 CCTGGAGACTGAGGCTACAGTGG + Intergenic
1098520654 12:71431860-71431882 CCTGGAGAGTGCGCCTCCTGTGG - Intronic
1100744796 12:97633846-97633868 CATGCAGACTGAGGCTCCCCAGG - Intergenic
1102493799 12:113305402-113305424 CCTGGAGAGAGCGGCCCTTCAGG + Intronic
1103971565 12:124675857-124675879 CCTGGAGCCTGCCGCTGGTCGGG + Intergenic
1107141062 13:36999166-36999188 CCTGGAGACTGCGGCTCCTCAGG - Intronic
1113335416 13:109372235-109372257 ACTGGAGACTGGGGGTCCTGGGG - Intergenic
1113424974 13:110200350-110200372 CCTGGACCCCGGGGCTCCTCAGG - Intronic
1113756752 13:112817621-112817643 CCTGCAGACTGTGGCTGGTCAGG + Intronic
1114063358 14:19038898-19038920 GCTGGAGAGTGGGGGTCCTCTGG + Intergenic
1114098898 14:19361098-19361120 GCTGGAGAGTGGGGGTCCTCTGG - Intergenic
1115912870 14:38275916-38275938 CCTGGGGACTGCTGCACCACAGG - Intergenic
1116258420 14:42587994-42588016 CCTGGTGCCTGCTGCTCTTCTGG + Intergenic
1119478441 14:74945405-74945427 CCTGGGGACTGCGCCCCCTAGGG - Intronic
1122093731 14:99356348-99356370 GATAGAGAATGCGGCTCCTCCGG + Intergenic
1122308997 14:100783033-100783055 CCTGGTGCCTGCAGCCCCTCTGG - Intergenic
1122346702 14:101065399-101065421 CTTGGAGGCTGGGGCACCTCGGG + Intergenic
1122859821 14:104577530-104577552 GCTGGAGATTGTGGCTACTCTGG - Intronic
1125721829 15:41848913-41848935 CCTGGACACAGTGGCTCCTGAGG - Intronic
1130158815 15:81378084-81378106 TCTCTAGACTGCTGCTCCTCTGG + Intergenic
1130542959 15:84835117-84835139 CCTGGAGACTGAGGCTGTGCTGG + Intronic
1132199880 15:99944052-99944074 CCTGGGGAGTGTGGCTGCTCTGG + Intergenic
1132471771 16:108108-108130 CCTGGGGACTGAGCCTCCCCAGG - Intronic
1132716027 16:1290191-1290213 TCTGGGAGCTGCGGCTCCTCGGG - Intergenic
1133058609 16:3160030-3160052 CCGGGAGCCTGCGACGCCTCTGG + Intergenic
1134675944 16:16090675-16090697 CTTGGGGAAGGCGGCTCCTCAGG + Intronic
1135480002 16:22814409-22814431 CCCGGGGGCAGCGGCTCCTCGGG - Exonic
1136024671 16:27461931-27461953 CCTGGGGCCTCCAGCTCCTCTGG - Intronic
1141643461 16:85354985-85355007 CCAGGAGGCGGCGGCACCTCAGG - Intergenic
1142055918 16:87995884-87995906 CCTGGAGGCTGGGGTTCCTGCGG + Intronic
1144770571 17:17757239-17757261 CCTGAAGACGGCAGCTCATCTGG + Intronic
1145023920 17:19453423-19453445 GCTGGAGACTGGGGCTCCCTGGG - Intergenic
1145262725 17:21364503-21364525 CCTGGAGACTGCGGCTGAGCTGG + Intergenic
1148851707 17:50558789-50558811 CCGGCAGACTGCGGCCTCTCGGG + Intergenic
1150003436 17:61455778-61455800 CCAGGAGAGTGTGGCTGCTCAGG + Intronic
1150456064 17:65307850-65307872 TCTGAAGACAGCGGCTCGTCTGG - Intergenic
1151849702 17:76683111-76683133 CCTGGGGACAGAGGCTGCTCAGG - Intronic
1152530859 17:80918308-80918330 CCTGGAGTCTGCATCTCCGCAGG - Intronic
1152648365 17:81480781-81480803 CCTGGAGACGGCCTCTCCTGTGG + Intergenic
1152853206 17:82649231-82649253 CCTGGAGACTGCGTGTCTTGGGG - Intergenic
1153028637 18:692879-692901 GCAGGAGACTGCTCCTCCTCCGG - Intronic
1157785076 18:50474338-50474360 GCTGGAGAGTGCTGCTGCTCTGG + Intergenic
1157806176 18:50659297-50659319 GCTGGAAATAGCGGCTCCTCGGG + Intronic
1160725779 19:617206-617228 CCTGAAGACAGTGGCTCCTGGGG + Exonic
1161954128 19:7483382-7483404 CCTGGACCCTGCCGCTTCTCAGG - Intronic
1163372107 19:16907060-16907082 CCTGGAGTCTGCTGCGCCCCTGG - Exonic
1163573575 19:18097810-18097832 CCTGGAGCCCGCGGCGCCGCAGG - Exonic
1164634494 19:29782274-29782296 CCTGCAGCCTGTGGCTCCCCAGG + Intergenic
1165796519 19:38523148-38523170 CCTGTGGGCTGCGGCTCCTCTGG - Intronic
1166834790 19:45660739-45660761 GCTGGGGAATGAGGCTCCTCTGG + Intergenic
1166843383 19:45712279-45712301 CCCGGAGGCGGCGGTTCCTCCGG + Exonic
1167072757 19:47230489-47230511 CGTGGAGTCTGCGGCTCCTGCGG - Intronic
1167246376 19:48375692-48375714 CCTGGGCACTGCTGCTCCCCAGG - Exonic
1167293287 19:48635907-48635929 CCTGGAGACTGCGGGCCCGGCGG - Exonic
1167797607 19:51719855-51719877 CCTGCAGCCTGCCGCTGCTCCGG - Exonic
1168423050 19:56217669-56217691 CCTGGCGCCTGCGGATCTTCTGG + Intergenic
1202694099 1_KI270712v1_random:112101-112123 GCTGGGCACTGCGGGTCCTCGGG - Intergenic
925808220 2:7673373-7673395 GCTGGAGGCTGCGGCTGCCCAGG + Intergenic
929061101 2:37925321-37925343 CCTGGAGCCCGCGGGTCCTAAGG - Intronic
933895681 2:86808177-86808199 CCAGGAAACCGCGGCTCCTGAGG + Exonic
933952461 2:87342474-87342496 GCTGGGCACTGCGGGTCCTCGGG + Intergenic
934236701 2:90238811-90238833 GCTGGGCACTGCGGGTCCTCGGG + Intergenic
936152468 2:110029429-110029451 CCTGGAGTCTCTGGGTCCTCAGG - Intergenic
936192212 2:110341983-110342005 CCTGGAGTCTCTGGGTCCTCAGG + Intergenic
937039532 2:118810104-118810126 CCAGGAAACTGCGGCCCATCTGG - Intergenic
938065921 2:128282018-128282040 CCTGGAGGCTGTGGCTCAGCAGG - Intronic
938781989 2:134592989-134593011 CCTGGAGCCTGAGGCTGCTTAGG - Intronic
940398324 2:153219474-153219496 CCTTGAGACAGCTGCTCTTCTGG - Intergenic
941221469 2:162787155-162787177 CCTGGAGACTGGGACTGCCCAGG - Intronic
943574932 2:189620123-189620145 CCTGGATTCTGTGGCTCCACTGG + Intergenic
944108171 2:196101966-196101988 CCTGGAGAGTAAGGCTCCTTTGG + Intergenic
944780729 2:203014687-203014709 CCTGTCGACTGCGGCTGCGCAGG + Intronic
946249040 2:218402005-218402027 CCTGGGGCCTGGGGTTCCTCTGG + Intronic
948696517 2:239735689-239735711 CCTGAAGACAGCTGCTCCTGTGG + Intergenic
948798600 2:240419914-240419936 CCTGCAGACCACGTCTCCTCCGG - Intergenic
948885265 2:240879047-240879069 CCTGGGGACTGCAGCTCATTTGG - Exonic
948942492 2:241203351-241203373 CGTGGAGCCTGCGGGCCCTCTGG - Exonic
1169375435 20:5063194-5063216 CCTGGAGACTTTTGGTCCTCTGG - Intergenic
1169379651 20:5095621-5095643 CCTTGAGACTGGACCTCCTCAGG - Intronic
1173622741 20:44449142-44449164 CCTGGAGACCTGGGCTGCTCTGG + Intergenic
1173770035 20:45648155-45648177 CCTGGAGCCTGGGGCTGCTGAGG + Intergenic
1174472336 20:50770229-50770251 CCAGGAGGCTGAGGCTCTTCAGG - Intergenic
1175980473 20:62736160-62736182 CCTGGAGCCTGGGGTGCCTCGGG + Intronic
1176121929 20:63457938-63457960 CCTGGAGACGGAAGCTCCGCAGG + Intronic
1177893456 21:26834004-26834026 CGTGAATACTGCTGCTCCTCTGG - Intergenic
1178534846 21:33403197-33403219 CCTGGAGACTGGAGCCCCGCGGG - Exonic
1179150855 21:38806621-38806643 CCTGAAGGCTGCGGCACCGCGGG + Intronic
1180481852 22:15761532-15761554 GCTGGAGAGTGGGGGTCCTCTGG + Intergenic
1181481322 22:23201003-23201025 CTAGGAGACTACGGCTTCTCAGG - Intronic
1182857479 22:33530714-33530736 CCTGGAGACTCAGGCTCTGCAGG - Intronic
1184470465 22:44692766-44692788 CCTGCAGACTGAGGCTCCTCAGG - Intronic
1184777140 22:46628845-46628867 CTTGGAGAATGTGGCTCCTGGGG + Intronic
1185109816 22:48894662-48894684 CCTGGAGATTGCGGCTCCAATGG - Intergenic
950485075 3:13268426-13268448 CCTGGAGACAGCAGCTTCCCTGG - Intergenic
952851741 3:37735036-37735058 CCTGGAGCCTGAGGACCCTCAGG - Intronic
953492399 3:43362917-43362939 CCTGGAGCCTCCAGCACCTCTGG - Intronic
954314794 3:49795312-49795334 CCTGGAGACCGCGGTGCCTGAGG + Exonic
959302056 3:104615407-104615429 ACTGGAGGCTGAGGCTCCTCAGG - Intergenic
960044666 3:113185369-113185391 CCAGGAGACTGAGTCTCCTCTGG - Intergenic
960829812 3:121834775-121834797 CCTGGACACTGCACCTCCCCAGG + Intronic
962320376 3:134385123-134385145 CCTGGCTGCTGCAGCTCCTCTGG - Intergenic
962754571 3:138457986-138458008 CCTGGGCTCTGCGGCACCTCAGG + Intronic
968547795 4:1207501-1207523 CATGGAAACAGCGGCTCTTCTGG - Intronic
968598855 4:1499685-1499707 CCTGGGCTCTGGGGCTCCTCAGG + Intergenic
969098418 4:4751453-4751475 CCTGGAGAACCTGGCTCCTCTGG - Intergenic
971480445 4:27109829-27109851 CCTGGAGACTGAATCTCATCAGG - Intergenic
972496404 4:39638816-39638838 CCAGAAGGCTGCGGCTGCTCCGG + Exonic
975753904 4:77552974-77552996 CATGAAGAGTGCGGCTGCTCAGG + Intronic
976148940 4:82073392-82073414 CCTGGAGACTGAATCTCTTCAGG + Intergenic
978852866 4:113358722-113358744 CCAGAAGACAGTGGCTCCTCAGG + Exonic
981647864 4:147020307-147020329 CCTGGAGTCTGGGGATGCTCTGG + Intergenic
982667045 4:158277771-158277793 CCTGGAGTCTGCTGCAGCTCTGG + Intergenic
983661475 4:170134250-170134272 CCTGGAGAGTGCTTCTCCTGTGG + Intergenic
986242499 5:5973572-5973594 CCTGAAGACTGTGGGTGCTCTGG - Intergenic
987060462 5:14238437-14238459 CCTGGAGGCTGCGAATGCTCTGG - Intronic
993547423 5:89229898-89229920 CCTGGAGCCTGGGGCTACACAGG + Intergenic
993547464 5:89230061-89230083 CCTGGAGCCTGGGTCTGCTCAGG + Intergenic
997057893 5:130467080-130467102 CCTGGAGACTGGGTCTACTGGGG - Intergenic
997291309 5:132737527-132737549 TCTCGAGACTGCGGCTTCTCGGG + Exonic
999634925 5:153611866-153611888 CCTTGAGCTTGCAGCTCCTCTGG + Intronic
1001645435 5:173278302-173278324 CCTGGAGCCTGGCCCTCCTCTGG + Intergenic
1002305217 5:178279101-178279123 CCTGCTGACTGCCCCTCCTCTGG + Intronic
1002465476 5:179406181-179406203 GCTGGAGACTGAAGCTCCCCCGG - Intergenic
1004322368 6:14642046-14642068 CCTGGGGACCGCGACTCCTGTGG + Intergenic
1004992437 6:21153842-21153864 CCTGGAGAATGCAGGTCCTCTGG + Intronic
1005997617 6:30940905-30940927 CATGGGGGCTGGGGCTCCTCAGG - Intergenic
1007630311 6:43269754-43269776 CCCGGCGGCGGCGGCTCCTCGGG + Intronic
1008294407 6:49757766-49757788 TCTGCAGACTGTGGCTGCTCAGG + Intergenic
1018628857 6:165805248-165805270 CCTGGAGGCAGCGGCTCCGAGGG + Intronic
1018962228 6:168457159-168457181 CCTGGAGATGGCAGCTCCTCTGG + Intronic
1019417788 7:935256-935278 CCTGGAGCCTTGGGCTACTCTGG - Intronic
1023980968 7:45069768-45069790 GCTGGAGACTGCGCCTTCCCAGG - Intronic
1025034850 7:55587674-55587696 TCTGGTGACTGCTTCTCCTCTGG + Intergenic
1026470907 7:70693908-70693930 CCTGGGGACCGCGCCTCCGCTGG + Intronic
1033220416 7:139523697-139523719 CGTGGAGGCTGCGGCTCGGCGGG + Intergenic
1034193108 7:149225889-149225911 AATGGAGACTGTGGCCCCTCGGG - Exonic
1034672607 7:152869783-152869805 CCGGGAGACTGTGGCTTATCTGG - Intergenic
1035217010 7:157375256-157375278 CCTGGAGCCTGCTGCTGTTCTGG + Intronic
1037512965 8:19602517-19602539 CCTGGAGCCTCCCGCTCCCCAGG + Intronic
1037925176 8:22838743-22838765 CCTGGCGACTGCGGCGGCTTAGG - Intronic
1038010566 8:23472577-23472599 CCTGGCCACTGAGGCACCTCTGG - Intergenic
1038613231 8:29072061-29072083 CCTGGACGCTGCGGCCCCGCCGG - Exonic
1039351941 8:36772794-36772816 CCTGGGGACAGTGGCTCCTAGGG - Intergenic
1039836941 8:41264079-41264101 CCTGGGGAGAGCTGCTCCTCTGG + Exonic
1039915290 8:41855898-41855920 CCTGGAGACTGCAGTCCCTGTGG + Intronic
1040015035 8:42692748-42692770 CCAGGAGCCTGCGGCTTCTGAGG + Intergenic
1042823013 8:72952456-72952478 CCTGAAGACTGCTGGCCCTCTGG - Intergenic
1046175771 8:110573058-110573080 CCAGGAGGCTGAGGCTACTCAGG + Intergenic
1049025485 8:139985491-139985513 GCTGGATGCTGCGGCACCTCAGG - Intronic
1049349401 8:142156150-142156172 CCTGGAGCCTGCGGCGGTTCTGG - Intergenic
1049354395 8:142180330-142180352 GCTGGGGACTGCGGAGCCTCTGG + Intergenic
1049543412 8:143218618-143218640 CCTGGAGCCTGGGACACCTCTGG - Intergenic
1052779095 9:32762147-32762169 CCTGGAGTCTTCGGCTCCCCTGG - Intergenic
1053106847 9:35416712-35416734 CCTGGAGAGTGCTCCTCCTATGG - Intergenic
1056469727 9:86893910-86893932 CCTAGAGACTGCTCCTCCCCAGG + Intergenic
1057128664 9:92638415-92638437 GCTGCATACTCCGGCTCCTCCGG + Intronic
1058686813 9:107487729-107487751 CCTGGCGGCTGCGGCTGCTGCGG + Exonic
1059320312 9:113463724-113463746 CCTGGAGACTCCGGTTACTGGGG + Intronic
1059449625 9:114362338-114362360 CCTGGAGACTGAGGGACCCCAGG + Intronic
1060553185 9:124495292-124495314 CCTGGAAACCGCGGCTCCATGGG - Intronic
1062100419 9:134725108-134725130 CCTGGAGACGGTGGCGTCTCCGG - Intronic
1062682466 9:137789135-137789157 ACGGGAGGCTGCGGCTCCCCAGG - Intronic
1188094355 X:26003387-26003409 CCTGGAGGGTGCGCCTCCTGTGG - Intergenic
1189310444 X:40014142-40014164 CCTGGAGACTGGAGCTCCCCAGG - Intergenic
1190776277 X:53554755-53554777 GCTGGAGACTGCAGCTCCTGAGG + Exonic
1192179490 X:68907498-68907520 CCTTGAGACTGGCTCTCCTCTGG + Intergenic
1192905467 X:75546257-75546279 CCTGGAGGGTGCTCCTCCTCTGG + Intergenic
1197858993 X:130949724-130949746 CCTGGAGACTCCAGCCCTTCTGG - Intergenic
1200169402 X:154061359-154061381 CCTGGTGTCTGTGGGTCCTCAGG - Intronic
1202124516 Y:21556546-21556568 CCCGCAGACCCCGGCTCCTCAGG + Intergenic
1202154492 Y:21872834-21872856 CCCGCAGACCCCGGCTCCTCAGG - Intergenic