ID: 1107141062

View in Genome Browser
Species Human (GRCh38)
Location 13:36999166-36999188
Sequence CCTGGAGACTGCGGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141062_1107141069 4 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1107141062_1107141068 3 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
1107141062_1107141066 -6 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141066 13:36999183-36999205 TCCAGGAGAGCGGTAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141062 Original CRISPR CCTGGAGACTGCGGCTCCTC AGG (reversed) Intronic