ID: 1107141065

View in Genome Browser
Species Human (GRCh38)
Location 13:36999175-36999197
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141065_1107141069 -5 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1107141065_1107141068 -6 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
1107141065_1107141076 24 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141065_1107141078 25 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141078 13:36999223-36999245 CCCTGTTCTCACCAGTACGAGGG 0: 1
1: 0
2: 1
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141065 Original CRISPR TACCGCTCTCCTGGAGACTG CGG (reversed) Intronic