ID: 1107141065

View in Genome Browser
Species Human (GRCh38)
Location 13:36999175-36999197
Sequence TACCGCTCTCCTGGAGACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141065_1107141076 24 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141065_1107141078 25 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141078 13:36999223-36999245 CCCTGTTCTCACCAGTACGAGGG 0: 1
1: 0
2: 1
3: 3
4: 83
1107141065_1107141068 -6 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
1107141065_1107141069 -5 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141065 Original CRISPR TACCGCTCTCCTGGAGACTG CGG (reversed) Intronic
901157185 1:7148761-7148783 CACCTCTCTCCAGCAGACTGGGG + Intronic
901331269 1:8410579-8410601 TACAGCATTCCTGCAGACTGGGG - Intronic
903882241 1:26518950-26518972 TACCTCTGACCTGGAGCCTGGGG - Intergenic
906459762 1:46028305-46028327 CAAGGCTCTCCTGGAGCCTGAGG + Intronic
915602632 1:156931942-156931964 CAACCCTCTCCTGGAGCCTGTGG + Exonic
920147098 1:203871573-203871595 TCCTGCTCTACTGGAGCCTGTGG + Intergenic
920340797 1:205274039-205274061 TACCGCTGATGTGGAGACTGAGG - Intergenic
921555575 1:216594710-216594732 TCCTCCTCTCCTGGAGACTTAGG + Intronic
924246910 1:242094173-242094195 TACAGTTCTCCTGGCAACTGGGG - Intronic
1065443685 10:25775802-25775824 TAGCTCTCTGCTGGAGACTGGGG + Intergenic
1066978508 10:42390650-42390672 TTCCTCTCTCCTGGATACTGGGG - Intergenic
1067539118 10:47138838-47138860 CACTTCTCTCCTGGAGACAGAGG + Intergenic
1069111275 10:64450234-64450256 CACAGCTCCCCTGGAGGCTGAGG + Intergenic
1069813741 10:71180452-71180474 CACAGTTCTCCTGGAGACAGGGG + Intergenic
1070546530 10:77457204-77457226 TACCCCTCGTCTGTAGACTGTGG + Intronic
1070968874 10:80547516-80547538 AACCCCTTTCCTGGACACTGGGG + Intronic
1075634823 10:124023367-124023389 TCCAGCTATTCTGGAGACTGAGG + Intronic
1077417691 11:2432520-2432542 TCACGCTCTCCTGGACACTGGGG - Intergenic
1084951651 11:72669642-72669664 TCCGGCTGTCCTGGAGGCTGGGG + Intronic
1096330411 12:50707558-50707580 TGCCGCTGTCCTGGAGGCTTCGG + Intronic
1107141065 13:36999175-36999197 TACCGCTCTCCTGGAGACTGCGG - Intronic
1111677036 13:91399660-91399682 TACCCCTTTGCTGGAGAATGGGG + Intronic
1117508932 14:56429421-56429443 TGCCCCTCTCCTGGAGACCTGGG + Intergenic
1120539149 14:85733630-85733652 TATACCTTTCCTGGAGACTGAGG + Intergenic
1120614646 14:86688582-86688604 TGCCGCTCTTGTGGAGCCTGGGG - Intergenic
1122228242 14:100291978-100292000 CACCGTTATCCTGGAAACTGAGG - Exonic
1123696368 15:22881836-22881858 TACGGCTCTCCTGGTGAGTGCGG - Exonic
1128175651 15:65553417-65553439 TACTGCTCTACTGGAGAGGGTGG + Intronic
1128638121 15:69316194-69316216 TCCAGCTATTCTGGAGACTGAGG - Intronic
1128770396 15:70277631-70277653 TGCTGCCCTCCTGGAGAATGTGG + Intergenic
1129519901 15:76178938-76178960 GGCAGCTCTCCTGGAGTCTGTGG + Intronic
1134089766 16:11385201-11385223 TCCTGCTCACCTGCAGACTGGGG + Exonic
1134751851 16:16631407-16631429 TACCTATCTCCTGAAGTCTGAGG - Intergenic
1134993621 16:18722296-18722318 TACCTATCTCCTGAAGTCTGAGG + Intergenic
1135728939 16:24878303-24878325 TACTGCAATCCTGGAGCCTGAGG + Intronic
1135848664 16:25942195-25942217 TGCCCCTAACCTGGAGACTGGGG + Intronic
1136374481 16:29857180-29857202 TTCTGCTCTCCTGGACACGGGGG + Intergenic
1143217407 17:5235148-5235170 TGTCGCTCTTCTTGAGACTGAGG - Intergenic
1147455251 17:40533774-40533796 TACCACTCTCCTTGTTACTGGGG + Intergenic
1147599713 17:41738353-41738375 TAGGGCTGTCCAGGAGACTGGGG + Intergenic
1149664914 17:58358568-58358590 TGCTGCTCTCCTGGAGCCCGGGG + Exonic
1151218004 17:72591185-72591207 CACCCCTCTCCTGCAGCCTGTGG - Intergenic
1155205657 18:23555824-23555846 TACTGCTGTCCTGGGGGCTGAGG - Intronic
1156736132 18:40262201-40262223 TCCCGCTATTCAGGAGACTGAGG + Intergenic
1161409967 19:4111701-4111723 TCCCGCACTCCGGGAGGCTGAGG + Intronic
1163555248 19:17988426-17988448 TACCGCGCTCGTGGTGGCTGTGG + Exonic
1163761979 19:19142258-19142280 TATCCCTATCCTGGAAACTGGGG + Intergenic
1164021916 19:21315251-21315273 TACAGCTCCCTTTGAGACTGTGG - Intronic
1168345255 19:55647687-55647709 TACCCCTCTCCCGGAAAATGAGG - Intronic
1168574260 19:57495608-57495630 TCCAGCTATCCTGGAGGCTGAGG + Intronic
1168689071 19:58366201-58366223 TCTCCCTCTCCTGGAGGCTGGGG + Intergenic
925615748 2:5743259-5743281 AGCTTCTCTCCTGGAGACTGTGG - Intergenic
926343511 2:11924502-11924524 TACCGCTCTTCTGAAGCCTCTGG + Intergenic
931831801 2:66060144-66060166 TACAGCTCTCCAGGTGGCTGGGG + Intergenic
937044750 2:118845322-118845344 TGCCGCTCTCCCAGACACTGCGG + Intronic
941995463 2:171597598-171597620 TAACACTCCCCTGGAGTCTGTGG - Intergenic
948850329 2:240702480-240702502 CACTGCTCTCCTGGTCACTGTGG + Intergenic
1171108266 20:22456663-22456685 TACCTTCCTCCTGGAGACTGCGG - Intergenic
1171202853 20:23255902-23255924 TCTCTCTCTCCTGGAGGCTGTGG + Intergenic
1173125553 20:40333010-40333032 TACAGCTCTGCAGGAGGCTGGGG - Intergenic
1175917501 20:62433480-62433502 TGCCTCTCTCCTGGAGGGTGTGG + Intergenic
1177603409 21:23345667-23345689 CCCAGCTCTTCTGGAGACTGAGG + Intergenic
1183879930 22:40818971-40818993 TCCTGGTCTCCTAGAGACTGCGG - Intronic
1185246538 22:49776022-49776044 TACGGCTCTCGTGGCGCCTGCGG - Intronic
952497174 3:33925970-33925992 TACCCTACTCCTGGAGCCTGAGG - Intergenic
959265684 3:104134680-104134702 AACAGCACTCCTGGAAACTGTGG + Intergenic
960936910 3:122910120-122910142 TACCGCCGTCCTGGGGACTTGGG - Exonic
962349633 3:134647225-134647247 CCCTGCTCTCCTGGAGGCTGTGG - Intronic
963130924 3:141856899-141856921 TGCCGCTCTCAGGCAGACTGTGG + Intergenic
963837656 3:150073287-150073309 TACAGTACTCCAGGAGACTGAGG + Intergenic
974927678 4:68321369-68321391 TACCGCTTTCCTGTAGTTTGGGG + Intronic
980805340 4:137805552-137805574 TACCACTCTGCTGATGACTGAGG + Intergenic
981932881 4:150209437-150209459 TACAGATCTCCTCGAGACTCTGG + Intronic
983802791 4:171956116-171956138 TCCCGCTACTCTGGAGACTGTGG - Intronic
984583309 4:181534915-181534937 TCCAGCTCTTCTGGAGGCTGTGG + Intergenic
986040331 5:3988045-3988067 TACCTCTCTGCTGAACACTGCGG - Intergenic
991044799 5:62211393-62211415 TTCTGCTTTCCTGGCGACTGCGG - Intergenic
997539493 5:134649508-134649530 TCCTGCTCTCTAGGAGACTGGGG - Intronic
997599622 5:135130409-135130431 TTCCTCTCCACTGGAGACTGAGG + Intronic
1003115754 6:3282979-3283001 TCCCGCCCTCGTGGAGTCTGCGG - Intronic
1004160139 6:13205725-13205747 ATGCGCTCACCTGGAGACTGTGG - Intronic
1004438845 6:15626833-15626855 TGCAGCTATTCTGGAGACTGAGG - Intronic
1005220780 6:23585970-23585992 AACCTCTCTCATGTAGACTGTGG + Intergenic
1005477559 6:26222699-26222721 TACAGCTACTCTGGAGACTGAGG + Intergenic
1016355401 6:143212670-143212692 TACCTCTCTCCTGAAGAGTGTGG - Intronic
1022131788 7:27411425-27411447 TACCGGTATCCTGGGGACCGGGG + Intergenic
1026798349 7:73380262-73380284 CCCAGCTCTCCTGGAGGCTGAGG + Intergenic
1028731010 7:94148519-94148541 GGCAGCACTCCTGGAGACTGGGG - Intergenic
1029222510 7:99001647-99001669 TTCCGCTCTCCTGTACACAGGGG + Intronic
1030434762 7:109502463-109502485 TAACACTCTCCTGGGGATTGCGG + Intergenic
1037585209 8:20271321-20271343 TTCCACTCTCCTGGAGTCTGTGG + Intronic
1039180691 8:34862621-34862643 TCCTGCTCTTCTGGAGAATGGGG + Intergenic
1041644688 8:60239217-60239239 TCCAGCTCCCCTGGAGGCTGAGG - Intronic
1042974729 8:74454988-74455010 AACCACTCTCTTGGAGATTGGGG - Intronic
1044344803 8:91092568-91092590 TACCGCTATACTGCAGCCTGGGG + Intergenic
1045489054 8:102655565-102655587 TGCCTCTCTCCAGCAGACTGCGG - Exonic
1046250482 8:111624344-111624366 TACCGCTGTTCTGGAGTCTGTGG + Intergenic
1049787584 8:144458462-144458484 TACTGCTGCCCAGGAGACTGGGG + Intronic
1052167111 9:25345404-25345426 TACCGCACTTCGGGAGGCTGAGG + Intergenic
1059449619 9:114362329-114362351 TGCCTCCCTCCTGGAGACTGAGG + Intronic
1060295825 9:122342453-122342475 TACCTCCCTCCTCCAGACTGTGG + Intergenic
1060375728 9:123114165-123114187 TACAGCTCTGCTGGGGACTGTGG - Intronic
1060761812 9:126258658-126258680 TACCACTCTCCTGGAGTTGGTGG + Intergenic
1062346955 9:136119285-136119307 CCCCGCCCTCCTGGAGCCTGGGG - Intergenic
1187658392 X:21508374-21508396 TACTGCTCTTTTGGGGACTGAGG + Intronic
1192573407 X:72224136-72224158 TTCCTTTCTCCTGGATACTGGGG + Intronic
1198086279 X:133285786-133285808 AATTGCTCACCTGGAGACTGAGG + Intergenic
1201256761 Y:12115277-12115299 TACCGCTGTCCTCCAGCCTGGGG + Intergenic