ID: 1107141068

View in Genome Browser
Species Human (GRCh38)
Location 13:36999192-36999214
Sequence GCGGTAAGCCCCGGCCTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141065_1107141068 -6 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 52
1107141062_1107141068 3 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141068 13:36999192-36999214 GCGGTAAGCCCCGGCCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141068 Original CRISPR GCGGTAAGCCCCGGCCTGCG CGG Intronic