ID: 1107141069

View in Genome Browser
Species Human (GRCh38)
Location 13:36999193-36999215
Sequence CGGTAAGCCCCGGCCTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141062_1107141069 4 Left 1107141062 13:36999166-36999188 CCTGAGGAGCCGCAGTCTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1107141065_1107141069 -5 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141069 Original CRISPR CGGTAAGCCCCGGCCTGCGC GGG Intronic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
907296650 1:53459981-53460003 CGGTCCGCATCGGCCTGCGCAGG - Exonic
908077350 1:60535172-60535194 CGGTCAGCCCCGGCCTACAGAGG - Intergenic
1063676040 10:8141275-8141297 CTGTCAGCCCCGCCCTGCCCCGG - Intergenic
1064011996 10:11742745-11742767 AGGTCAGCCCCGGGCCGCGCGGG + Exonic
1070642621 10:78180531-78180553 AGGTCAGCCCCGGCCAGAGCAGG + Intergenic
1072607555 10:96997468-96997490 GGGTAAGGCCAGGCCTGGGCAGG - Intergenic
1076268826 10:129132794-129132816 AGGTCATCCCCGGCCTGCGAGGG - Intergenic
1077097483 11:805158-805180 AGGTACGCGCCGGCCTGGGCGGG - Exonic
1078660054 11:13278583-13278605 CGGGAATCCCCGGCCGGCACGGG + Intronic
1092122875 12:6056898-6056920 AGCTATGCCGCGGCCTGCGCGGG - Exonic
1098161284 12:67649445-67649467 CGCCAAGCCCCGGGCAGCGCAGG - Intronic
1101605152 12:106242839-106242861 CTGTCAGCCCTGACCTGCGCTGG + Intronic
1104748093 12:131222328-131222350 TGGTAAGCCCCGGCCTCCCGTGG + Intergenic
1106087722 13:26558033-26558055 CGAGAAGCCCCTGCCAGCGCGGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1115349979 14:32383635-32383657 CAATAAGCCCAGGCCTGCTCTGG + Intronic
1118404809 14:65412745-65412767 GGGGAAGCCTCGGCCAGCGCCGG - Intronic
1122601241 14:102922969-102922991 CGGCCAGCCCCGGCCTCCGGCGG + Intronic
1132480948 16:165871-165893 CGGGGACCCTCGGCCTGCGCCGG - Intronic
1133020275 16:2964062-2964084 CGGGAAGCCCCGCCCAGCACTGG - Exonic
1139513561 16:67440703-67440725 CTGTGAGCCCAGGCCTGCCCTGG + Intronic
1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG + Intergenic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1152791555 17:82282951-82282973 CGGTGTGCCCAGCCCTGCGCAGG - Intergenic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160884797 19:1340870-1340892 CGTTAAGCCGCCGCCTGCCCAGG + Intergenic
1160932962 19:1579256-1579278 AGGTGACCCCCGGCCTGCGAGGG - Intronic
1167347427 19:48955210-48955232 CGACAAGCCCGGGCCTGCCCGGG - Intronic
1167643623 19:50694843-50694865 CGGCAGGCCCCGGCCCGCGGTGG - Intronic
927949627 2:27158881-27158903 AGCTCAGCCCCGGCCTGGGCCGG - Intergenic
936068114 2:109347586-109347608 TGAGAAGCCCCGGCCTGCCCCGG + Intronic
937203871 2:120223513-120223535 CGGGAAGCCGCGGCGAGCGCGGG - Intergenic
939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG + Intronic
949059303 2:241947554-241947576 CGGTAAGCCCAGGTCTGGGCAGG - Intergenic
1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG + Intronic
1175241038 20:57549124-57549146 CGGGAAGCCAGGGCCTGCACGGG - Intergenic
1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG + Intronic
1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG + Exonic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG + Intronic
1185336284 22:50272092-50272114 CGGGAACCCCCTGCCTGCCCAGG + Intergenic
974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG + Intergenic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG + Intergenic
994932402 5:106206152-106206174 GGGGAGGCTCCGGCCTGCGCAGG + Intergenic
997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG + Exonic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1006378745 6:33685688-33685710 CGCTGGGCCCCAGCCTGCGCCGG + Exonic
1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG + Intronic
1007637641 6:43308729-43308751 CGGTGAGGCCCGGGCTGCGGAGG - Exonic
1018928329 6:168222531-168222553 GGGTAAGCCCCAGCCTGAGGGGG - Intergenic
1019427702 7:985157-985179 CGGGAAGGGCCGGCCTGCGAGGG - Exonic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1024323148 7:48089195-48089217 CGGTAACCCCCGGGCAGGGCGGG + Exonic
1029111426 7:98214734-98214756 CAGGAAGCCCTGGGCTGCGCTGG - Exonic
1034843035 7:154417461-154417483 CCGTAAGCCCCAGCCTGTGAAGG + Intronic
1057076629 9:92141515-92141537 CGGTAGGCCCCGGGCCGGGCTGG - Intergenic
1057359734 9:94362133-94362155 CAGTAGGCCCCGGACTGCCCTGG + Intergenic
1057663609 9:97025956-97025978 CAGTAGGCCCCGGACTGCCCTGG - Intergenic
1059107133 9:111521577-111521599 GGGCAAGCCCCTCCCTGCGCTGG + Intergenic
1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG + Exonic
1186747343 X:12583556-12583578 CGGTTAGGCCTGGCTTGCGCTGG - Intronic