ID: 1107141076

View in Genome Browser
Species Human (GRCh38)
Location 13:36999222-36999244
Sequence TCCCTGTTCTCACCAGTACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107141073_1107141076 -7 Left 1107141073 13:36999206-36999228 CCTGCGCGGGTTCCCATCCCTGT 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141067_1107141076 15 Left 1107141067 13:36999184-36999206 CCAGGAGAGCGGTAAGCCCCGGC 0: 1
1: 0
2: 1
3: 6
4: 63
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141072_1107141076 -3 Left 1107141072 13:36999202-36999224 CCGGCCTGCGCGGGTTCCCATCC 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141070_1107141076 -1 Left 1107141070 13:36999200-36999222 CCCCGGCCTGCGCGGGTTCCCAT 0: 1
1: 0
2: 0
3: 8
4: 60
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141065_1107141076 24 Left 1107141065 13:36999175-36999197 CCGCAGTCTCCAGGAGAGCGGTA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1107141071_1107141076 -2 Left 1107141071 13:36999201-36999223 CCCGGCCTGCGCGGGTTCCCATC 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1107141076 13:36999222-36999244 TCCCTGTTCTCACCAGTACGAGG 0: 1
1: 0
2: 1
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107141076 Original CRISPR TCCCTGTTCTCACCAGTACG AGG Exonic