ID: 1107145853

View in Genome Browser
Species Human (GRCh38)
Location 13:37059705-37059727
Sequence GGGCGGGGAAGGCGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1719
Summary {0: 1, 1: 0, 2: 11, 3: 152, 4: 1555}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107145833_1107145853 27 Left 1107145833 13:37059655-37059677 CCAACAGCCAGTTCCGGCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1555
1107145841_1107145853 -1 Left 1107145841 13:37059683-37059705 CCGATTGGCAGGCTGGGCCGAGG 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1555
1107145835_1107145853 14 Left 1107145835 13:37059668-37059690 CCGGCGGCCGCACTTCCGATTGG 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1555
1107145831_1107145853 30 Left 1107145831 13:37059652-37059674 CCACCAACAGCCAGTTCCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 61
Right 1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1555
1107145834_1107145853 20 Left 1107145834 13:37059662-37059684 CCAGTTCCGGCGGCCGCACTTCC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1555
1107145838_1107145853 7 Left 1107145838 13:37059675-37059697 CCGCACTTCCGATTGGCAGGCTG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107145853 Original CRISPR GGGCGGGGAAGGCGGGCGGA AGG Intronic
900180290 1:1308181-1308203 GCGCGGGGAGGGCGCGGGGAGGG + Intronic
900182136 1:1315767-1315789 GGGCGGGGAGGGAGGGAGGGAGG + Intronic
900214136 1:1472107-1472129 GGGCGGGGCGGGCGGGCGGGCGG + Intronic
900221684 1:1512491-1512513 GGGCGGCGCGGGCGGGCGGGCGG + Intronic
900348745 1:2224853-2224875 GGGCGGGGCTGGAGGGTGGAAGG + Intergenic
900364904 1:2307362-2307384 GGGCGGGGTAGGCGGCAGTAAGG - Exonic
900513135 1:3069598-3069620 GGGCCGGGGAGGGGGGCGGAGGG + Intronic
900607877 1:3531813-3531835 GGGCGGGGGAGGGGGGCCGCGGG + Intronic
900614736 1:3560461-3560483 GGGTGAGGAAGGAGGGAGGAAGG - Intronic
900642345 1:3693783-3693805 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642376 1:3693888-3693910 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642398 1:3693959-3693981 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642429 1:3694064-3694086 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642449 1:3694134-3694156 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642472 1:3694205-3694227 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642528 1:3694382-3694404 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642559 1:3694487-3694509 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642590 1:3694592-3694614 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900642679 1:3694908-3694930 GGGCTGGGATTGCGGGAGGAGGG - Intronic
900859074 1:5212230-5212252 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
900970812 1:5991777-5991799 GGGCGGGGAGGAGGGGCGGAGGG + Intronic
900982119 1:6051759-6051781 GGGCCGGGCAGGGGGGCGGTGGG + Intronic
901101321 1:6721299-6721321 GGGTGGCCAAGGCAGGCGGATGG - Intergenic
901107305 1:6766925-6766947 GGGAGGCCAATGCGGGCGGATGG - Intergenic
901109852 1:6785677-6785699 GGGCGCGGCGGGCGGGCGGGCGG + Intronic
901279584 1:8023516-8023538 GGGAGGCCAAGGCGGGCAGATGG - Intronic
901279875 1:8026024-8026046 GGGCGTGGAGGGCGCGGGGAGGG - Intronic
901304285 1:8221426-8221448 GGGAGGTGAAGGCAGGAGGATGG - Intergenic
901361286 1:8703144-8703166 GGGCGGCGCAGGCGGGCAGGTGG + Intronic
901526089 1:9824096-9824118 GGGCGGGGGAGAGGAGCGGAGGG + Exonic
901529562 1:9844466-9844488 GGGCTGGGAAGGCAGGAGGAGGG + Intergenic
901636388 1:10672207-10672229 GGGAGGGGGTGGCGGGGGGAGGG - Intronic
901636445 1:10672472-10672494 GGGGCGGGCCGGCGGGCGGAGGG - Intronic
901704081 1:11060255-11060277 GGGCGGGCTGGGCCGGCGGAAGG + Intergenic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901904002 1:12392250-12392272 GGGAGGCCAAGGCGGGCAGATGG + Intronic
902036551 1:13462429-13462451 GGGAGGGTAAGGTGGGAGGATGG - Intergenic
902044326 1:13513710-13513732 GGGCGGGGAGGGCGTGCGCCCGG + Exonic
902044362 1:13513802-13513824 GGGCGGGGAGGGAGGGGCGAGGG + Exonic
902336790 1:15758747-15758769 GGGCGGGGAGGGCGGACGGGCGG + Intronic
902353696 1:15879907-15879929 GGGAGGTCGAGGCGGGCGGATGG - Intronic
902374043 1:16021931-16021953 CGGCGGGGAAGGGGGGTGGCAGG + Intronic
902388570 1:16089674-16089696 GGGAGGGGAAGGGAGGGGGAGGG + Intergenic
902515323 1:16986766-16986788 GGGCGGGAGATGCTGGCGGAGGG - Intronic
902564980 1:17305517-17305539 GGGCAGGGAAGGCTGAGGGAAGG - Intergenic
902690471 1:18107689-18107711 GGGAGGGCAAGGAGGGCGGGGGG + Intergenic
902784700 1:18725418-18725440 AGGAGGGGCAGGCGGGAGGAAGG - Intronic
902813721 1:18904206-18904228 GGGAGGGGTAGGAGGACGGAAGG - Intronic
902833597 1:19033405-19033427 GGGTGGGGAGGGTGGACGGAGGG - Intergenic
902874919 1:19335188-19335210 GGGAGGCCAAGGCGGGAGGAGGG + Intergenic
902893339 1:19461087-19461109 GGGCGGGGGCGGGGGGGGGAGGG + Intronic
903029236 1:20451036-20451058 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
903163073 1:21503090-21503112 GGGAGGCCAAGGCGGGCGGCTGG + Intergenic
903216431 1:21846068-21846090 GGGACGGGAAGGCCGGGGGAGGG - Intronic
903233797 1:21937113-21937135 GGGCGGGGGGCGGGGGCGGAGGG - Intronic
903263431 1:22143145-22143167 CGGCGGCGGAGGCGGGCGGGCGG + Intronic
903297139 1:22350943-22350965 GGGCGGGGGAGGGGGCAGGAAGG - Intergenic
903314909 1:22495753-22495775 GGGAGGCCAAGGCGGGTGGATGG - Intronic
903319459 1:22533570-22533592 GGGCGGGGAAGGGGGCCTGTGGG + Intergenic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903349679 1:22710447-22710469 GGGCAGGGAGAGCGGACGGAGGG - Intergenic
903568581 1:24287044-24287066 GGGCAGGGAGGGTGGGCGGAGGG - Intergenic
903679785 1:25089203-25089225 GGGAGGGGAAAACGGGAGGAAGG + Intergenic
903750197 1:25616744-25616766 GGGCGTGGCCGGCGGGCGGCAGG + Intergenic
903844264 1:26268216-26268238 GGGAGGCCAAGGTGGGCGGATGG + Intronic
903878898 1:26495254-26495276 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
904028898 1:27521714-27521736 GGGCTGGGAAGGCTGGGGGCTGG - Intergenic
904137887 1:28328212-28328234 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
904300550 1:29550810-29550832 GGGCGAGTAAGGCTGGGGGAGGG - Intergenic
904457656 1:30657234-30657256 GGGCGAGTAAGGCTGGGGGAGGG + Intergenic
904500156 1:30908598-30908620 GGGCGCGGGCGGCGGGCGGCGGG + Exonic
904612248 1:31732168-31732190 GGGAGGGGCAGGTGGGCAGAGGG + Intronic
904618199 1:31761066-31761088 GTTCCGGGGAGGCGGGCGGAGGG - Intronic
904618928 1:31764062-31764084 GCGCGGGGCGGGCGGGCGGGCGG + Intronic
904822704 1:33256075-33256097 GCGCGGCTCAGGCGGGCGGAGGG + Intergenic
905553077 1:38859518-38859540 AGGCGGCGGCGGCGGGCGGAGGG - Exonic
905584386 1:39105472-39105494 GGCCGGGCGAGGCGGGCGGACGG + Intronic
905766445 1:40605561-40605583 GGGAGGCCAAGGCGGACGGATGG + Intergenic
905793532 1:40802636-40802658 GGGCGGGGGAAGGGGGCCGAGGG + Intronic
905812637 1:40923721-40923743 GGGATGGGAATGGGGGCGGAAGG + Intergenic
906069664 1:43007676-43007698 GGGCGGGGACGGGGAGGGGAGGG - Intergenic
906215098 1:44033949-44033971 GGGAGGGGATGGGGGACGGACGG + Intergenic
906501292 1:46343134-46343156 GGGCAGGGATGGGGGGTGGAGGG - Intronic
906503213 1:46357420-46357442 GAGAGGCCAAGGCGGGCGGATGG - Intronic
906545741 1:46618031-46618053 GGGAGTGGAGGGCGGGAGGAGGG + Intergenic
906575333 1:46884341-46884363 GGGAGGCCAAGGTGGGCGGATGG - Intergenic
906980295 1:50621924-50621946 GGGAGGCCAAGGCAGGCGGATGG + Intronic
907069306 1:51519364-51519386 GGGCGGGGCGGGCGTGGGGAGGG - Intergenic
907439488 1:54470264-54470286 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
907704141 1:56818638-56818660 GGGCAGGGAATGCTGGCGTAGGG + Intronic
908501144 1:64745034-64745056 CCGCGGGGAAGGGGGGCGGTGGG - Intergenic
909616946 1:77621574-77621596 GGGAGGCCAAGGTGGGCGGATGG + Intronic
909738755 1:79001176-79001198 GGGGGGGGAGGGAGGGAGGAAGG + Intronic
910148258 1:84108323-84108345 GAGGGTGGAAGGCGGGAGGAGGG + Intronic
910182992 1:84505976-84505998 GGGCGGCCGAGGCGGGAGGAAGG - Intronic
910232269 1:84998297-84998319 GGGCGCGGAGGGAGGGCGCACGG + Intergenic
910582102 1:88839845-88839867 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
910846962 1:91613055-91613077 GGGAGCGGAAGGCAGGCGGATGG + Intergenic
910963369 1:92784787-92784809 GGGCCGGGAGGCCGGGCGGGCGG - Intronic
911115005 1:94237624-94237646 GGGCGGGGCTGGCGGGCGGGCGG - Intronic
912433726 1:109643809-109643831 GCGCGGGAGAGGCAGGCGGAGGG + Intergenic
913183867 1:116348904-116348926 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
913960312 1:143334018-143334040 GGGCGGGCCAGGCGTGCGGTGGG + Intergenic
914054668 1:144159591-144159613 GGGCGGGCCAGGCGTGCGGTGGG + Intergenic
914124478 1:144806770-144806792 GGGCGGGCCAGGCGTGCGGTGGG - Intergenic
914763435 1:150617555-150617577 GGGAGGCCAAGGCGGGCGGATGG - Intronic
915213434 1:154325856-154325878 GGGCGGGGATGGCGGCCGACTGG + Intronic
915446745 1:155978481-155978503 GTTGGGGGAAGGCGGGGGGAGGG + Exonic
915511345 1:156388561-156388583 GGGCGGCGGCGGCGGGCGCACGG - Intergenic
915555848 1:156660245-156660267 GGGAGGGGAAGGGGGGTGGCTGG + Intergenic
915588740 1:156859141-156859163 GGGCGGGGAGGGCGGGAGCTGGG - Intronic
915631319 1:157155570-157155592 GGGCTGGAAAGGCGGGGGGCTGG + Intergenic
915725588 1:158014682-158014704 GGGGGGGGGGGGCGGGGGGAAGG + Intronic
915852701 1:159343049-159343071 GTGGGGGGGGGGCGGGCGGAGGG + Intergenic
915951396 1:160191996-160192018 GGGTGGGGAAGGGAGGCGGTTGG - Intronic
916046677 1:161005278-161005300 GGGAGGGGAAGGAGGAAGGAGGG - Intronic
916107725 1:161443113-161443135 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916109309 1:161450486-161450508 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916110896 1:161457917-161457939 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916112482 1:161465277-161465299 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916114066 1:161472694-161472716 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916174374 1:162025296-162025318 GGGAGGGCAAGGCGGATGGATGG - Intergenic
916233442 1:162562016-162562038 GGGCTGGGCAGCCGGGTGGATGG + Intronic
916412343 1:164559034-164559056 GGGCGGGGAAGCCGGGAGGCTGG - Intronic
916646126 1:166786777-166786799 GAGCGGGGAGGGTGGGAGGAGGG - Intergenic
916792648 1:168137083-168137105 CAGCCGGGAGGGCGGGCGGACGG - Intronic
917027794 1:170661675-170661697 GGGCGGGGAGAGTGGGGGGAGGG + Intergenic
917031879 1:170701998-170702020 GATGGGGGAAGGCGGGGGGAGGG + Intronic
917349911 1:174066102-174066124 GGGCGAGGAGGGCGGGCGGATGG + Intergenic
918273311 1:182924826-182924848 GGTGGGGGAAGGAGGGAGGAAGG + Intronic
918328701 1:183435140-183435162 TGGCGGGGAGGGAGGGGGGACGG - Intergenic
918620755 1:186602069-186602091 GTGGGGGGAGGGCGGGGGGACGG - Intergenic
919748101 1:201021185-201021207 GGGCTGGGAAGGAGAGCAGATGG - Intronic
919820600 1:201469437-201469459 TGGCGGGGAAGGGAGGGGGAAGG + Intergenic
919868343 1:201801065-201801087 GGGAGGCCAAGGCGGGAGGATGG - Intronic
920003023 1:202812219-202812241 GGGCAGGGAATGGGGGAGGATGG - Intergenic
920022652 1:202967276-202967298 GGGCGGGGCAGGCCGGGGGCGGG + Exonic
920065560 1:203266903-203266925 GGGAGGCCAAGGCGGGCAGATGG - Intronic
920572136 1:207025090-207025112 GGGCGGGGAGGCGGGGGGGAGGG + Intronic
920657588 1:207888028-207888050 GGGAGGGGGAGGTGGGAGGAAGG + Intronic
920694480 1:208171607-208171629 GGGAGGCCAAGGCGGGAGGATGG + Intronic
920735193 1:208527167-208527189 GGCCGGGGGAGGGGGGCAGAAGG - Intergenic
921024771 1:211267830-211267852 GGGAGGCCAAGGAGGGCGGATGG - Intronic
921177655 1:212608314-212608336 GGGCGGGGAAGGTGGGGAGGCGG - Intronic
921185373 1:212665527-212665549 GGGCGAGGAAGGAGGAGGGAGGG - Intergenic
921186713 1:212676703-212676725 GGGAGGCCAAGGTGGGCGGATGG + Intergenic
921324911 1:213980282-213980304 GCGCGGGGGAGGTGGGTGGAGGG - Intergenic
921357022 1:214294426-214294448 GGGAGGCCAAGACGGGCGGATGG + Intronic
921380515 1:214519808-214519830 GGGAGGCCAAGGGGGGCGGACGG + Intronic
921697724 1:218231376-218231398 GGGAGGCCGAGGCGGGCGGATGG - Intergenic
922116310 1:222617929-222617951 GGGCGGGGACGGGGCGGGGACGG - Intergenic
922116338 1:222617976-222617998 GGGCGGGGACGGGGCGGGGACGG - Intergenic
922116363 1:222618019-222618041 GGGCGGGGACGGGGCGGGGACGG - Intergenic
922176154 1:223199691-223199713 GGGGGGGGAAGGGGGGAGGGGGG - Intergenic
922648578 1:227317964-227317986 GGGGGTGGAAGGCGGGCTGCGGG + Exonic
922695306 1:227728417-227728439 GGGCAGGCAGGGCGGGCGGCGGG - Intergenic
922925238 1:229342551-229342573 CGGCGGGCAGGGCCGGCGGAGGG - Intronic
923039326 1:230308597-230308619 GGGGTGGGGAGGCGGGAGGAAGG + Intergenic
923094403 1:230763043-230763065 GAGCTGGGAAGGCAAGCGGAGGG + Intronic
923098735 1:230795620-230795642 GGGCGGGGAAGGGGGGAGGAAGG - Intronic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923614334 1:235524434-235524456 AGGCGGGGAGGGAGGGCAGAAGG + Intergenic
923859969 1:237883640-237883662 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923859988 1:237883671-237883693 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923859994 1:237883681-237883703 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923860000 1:237883691-237883713 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923860006 1:237883701-237883723 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923860012 1:237883711-237883733 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
924085653 1:240448901-240448923 GGGGGGCCAAGGCGGGTGGATGG + Intronic
924118877 1:240776422-240776444 GGGAGGGGTAGGAGGGTGGAGGG - Intronic
924289598 1:242524337-242524359 GGGCGCGGAGGGCGAGCGGGAGG + Exonic
924414855 1:243849431-243849453 TGGCGGGGAAGGGTGGGGGAAGG + Intronic
924424030 1:243934037-243934059 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
924728057 1:246688281-246688303 GGGAGGCTAAGGCGGGCGAATGG - Intergenic
924953526 1:248906662-248906684 GGGCGGGGTGGGCGGGACGAAGG + Intronic
1062843785 10:689685-689707 GGGCGCGGGAGGCGGGCGGCGGG + Intronic
1062894585 10:1093051-1093073 AGGCTGGGAAGGAAGGCGGATGG + Intronic
1063415638 10:5870623-5870645 GGGAGGCCAAGGCGGGCAGATGG - Intronic
1063567002 10:7180013-7180035 GGGCTGGGGAAGCTGGCGGATGG + Intronic
1063681255 10:8189710-8189732 GGGCGGGAAATGGAGGCGGAAGG + Intergenic
1063917868 10:10902920-10902942 GGGAGGGAAAAGCGGGAGGAAGG + Intergenic
1064070839 10:12226888-12226910 GGGAGGCGAAGGCAGGCGGCTGG + Intronic
1064152425 10:12876019-12876041 GGGAGGGCAAGGCAGGAGGATGG - Intergenic
1064208956 10:13347754-13347776 GGCCGGGGAAGGAGGGAGGGAGG - Intronic
1064224053 10:13466990-13467012 GGGCTGGGAAGGCGGGTGCGGGG + Intronic
1064503991 10:16009631-16009653 GGGTGGGGAGGGTGGGAGGACGG + Intergenic
1064562640 10:16608068-16608090 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1064740866 10:18432729-18432751 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1064752403 10:18544398-18544420 GGGCGGGGCGGGGGGGCGGGCGG + Intergenic
1065315247 10:24457638-24457660 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1065366636 10:24943789-24943811 GGGAGGCTAAGGCAGGCGGATGG - Intronic
1065368807 10:24960827-24960849 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1065384858 10:25124722-25124744 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1065483447 10:26216031-26216053 GGGAGGGGACGGCGGGGGAAGGG - Intergenic
1065487619 10:26249921-26249943 GGGCGGAGAAGGAGGCAGGAGGG + Intronic
1065582295 10:27183949-27183971 GGGAGGCCAAGGTGGGCGGATGG - Intronic
1065728711 10:28691537-28691559 GGGAGGGGGAGGGAGGCGGAGGG - Intergenic
1066144855 10:32547120-32547142 GGGAGGGTGAGGCGGGAGGATGG - Intronic
1066569376 10:36754347-36754369 GGGCCGGGAAGGGGAGGGGAGGG + Intergenic
1066572744 10:36791124-36791146 GGGAGGCCCAGGCGGGCGGATGG + Intergenic
1067059908 10:43072967-43072989 GGGAGGAGAAGACGGGCAGAGGG + Intergenic
1067112584 10:43410581-43410603 GGGAGGCGTAGGTGGGCGGATGG - Intergenic
1067131145 10:43566523-43566545 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1067175598 10:43943508-43943530 GAGCGGGGAAGAGGGGTGGAGGG + Intergenic
1067359310 10:45563018-45563040 GGGAGGGGAAGGAGAGAGGAAGG - Intronic
1067449251 10:46371220-46371242 GGGCAGGGAAGGAGGGAGGGAGG + Intronic
1067588119 10:47489545-47489567 GGGCAGGGAAGGAGGGAGGGAGG - Intronic
1067635244 10:47997636-47997658 GGGCAGGGAAGGAGGGAGGGAGG - Intergenic
1067686098 10:48466739-48466761 GGCCGGGGCGGGCGGGCGGCGGG - Intronic
1068032263 10:51718385-51718407 GGCCGGGGAAGGCGAGAGTAGGG + Intronic
1068696424 10:59972572-59972594 GGGAGGCCAAGGCGGGTGGATGG - Intergenic
1068731476 10:60363080-60363102 GGGCGGGGGAGGGGGGCGGGGGG + Intronic
1068877032 10:62008035-62008057 GGGCGGGGGAGGTGGGTGGAGGG - Intronic
1069059177 10:63875932-63875954 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
1069212025 10:65773494-65773516 GGGAGGCCAAGGCGGGCGGGAGG - Intergenic
1069381762 10:67849245-67849267 GGGCAGGGAAGGGGAGGGGAGGG + Intergenic
1069381778 10:67849275-67849297 GGGCAGGGAAGGGGAGGGGAGGG + Intergenic
1069695547 10:70382763-70382785 GCGCGGGGGTGGCGCGCGGAAGG + Intergenic
1069926084 10:71851600-71851622 GGGAGGCCGAGGCGGGCGGAGGG + Intergenic
1070162429 10:73874265-73874287 GGGCGGGAAAGGCGGGGGTGGGG + Intronic
1070199835 10:74193395-74193417 GGTGGGGGGAGGCGGGAGGAGGG - Intronic
1070255965 10:74813536-74813558 AGGCAGGGGAGGCGGGCGGAGGG - Intergenic
1070258038 10:74827008-74827030 GGGCGGGGCTCGAGGGCGGAGGG + Intronic
1070297802 10:75178787-75178809 GGGAGGCCAAGGCAGGCGGATGG + Exonic
1070314136 10:75294794-75294816 GGCCCGGGAGGGCGCGCGGAGGG + Intergenic
1070455997 10:76616215-76616237 GAGGGTGGAAGGTGGGCGGAGGG + Intergenic
1070768767 10:79070492-79070514 CGGGCGGGAGGGCGGGCGGACGG + Intronic
1070828190 10:79403437-79403459 GGCCGGGGGAGGCAGGTGGAAGG + Intronic
1070869672 10:79739656-79739678 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1071600951 10:86958499-86958521 GGGCGGGGAGGGAGGGAGGGAGG - Intronic
1071669873 10:87598357-87598379 GGGAGGCTAAGGCGGGCAGATGG + Intergenic
1071857839 10:89644565-89644587 GGGAGGGGAGCGCGGGCGCAAGG - Intronic
1072645622 10:97251509-97251531 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1072645628 10:97251520-97251542 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1072645634 10:97251531-97251553 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1072750429 10:97974932-97974954 GGGAAGGGGAGGCGGGCAGAGGG + Intronic
1072879823 10:99215459-99215481 CGGCGGGGTAGGGGGGCGAAAGG + Intronic
1073049656 10:100659398-100659420 GGGCGGGGCAGGCGAGCGTGAGG - Intergenic
1073212812 10:101818480-101818502 AGGCGGGGGAGCCGGGCGGAGGG - Intergenic
1073336755 10:102715275-102715297 GGGAGGCCTAGGCGGGCGGATGG - Intronic
1073348477 10:102802021-102802043 GGGAGGGGAGGGTGGGGGGAAGG - Intronic
1073422322 10:103434373-103434395 GGTCGGGGAAGGGGAGCGGCAGG + Intronic
1073593732 10:104780017-104780039 GGGAGGGGAAGGGAGGTGGAAGG + Intronic
1073955807 10:108870030-108870052 GGGCGGGGAAAGAGGGAGGTGGG + Intergenic
1074578512 10:114693900-114693922 GGGAGGGCAAGGCGGGAGGATGG - Intergenic
1074629438 10:115234826-115234848 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1074772466 10:116742688-116742710 GGTCGGGGAAGGCGGGCGCGGGG + Intergenic
1075129419 10:119725829-119725851 GAGCGGGAGGGGCGGGCGGAAGG + Intergenic
1075382258 10:122028926-122028948 GGGAAGGGAAGGCGAGGGGAGGG - Intronic
1075519616 10:123135995-123136017 GAGCGGGACAGGCGGGCGGCGGG - Exonic
1075616100 10:123891775-123891797 GGGCGCGGGAGGCGGCCGGCTGG + Exonic
1075717223 10:124563506-124563528 GGGCGGGGCAGGAGGGCAGTGGG + Intronic
1075741444 10:124698753-124698775 GGGTGGGGAATGGGGGCCGAGGG - Intronic
1075745002 10:124720958-124720980 GGGAGGCCAAGACGGGCGGATGG + Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076188154 10:128464617-128464639 AGGAGGGGAAGGCAGGAGGATGG - Intergenic
1076232417 10:128832567-128832589 GGGGAGGGAAGGGGAGCGGAGGG + Intergenic
1076394542 10:130129176-130129198 GGGATGGGAAGGCGCGGGGATGG - Intergenic
1076405942 10:130212657-130212679 GGGAGGGGAAGGGGGCCTGATGG - Intergenic
1076535420 10:131173943-131173965 GGACTGGGAAGGAGGGAGGAGGG + Intronic
1076678011 10:132158067-132158089 GGGCGGGGCGGGGGGGCGGTGGG - Intronic
1076792864 10:132786066-132786088 GGGCGCGGGGGGCGGGCGGGCGG + Intergenic
1076792876 10:132786094-132786116 GCGCGGGGCGGGCGGGCGGGCGG + Intergenic
1076852766 10:133101193-133101215 GGGCGGGGCAGGCGGGAAGGCGG - Intronic
1077008309 11:369362-369384 GGGCGGAGGAGGCGGGGCGAGGG - Intergenic
1077122079 11:914274-914296 GGGCTGGGAATGGGGGCTGAGGG - Intronic
1077204539 11:1336327-1336349 GGGCGGGGGAGGGGGGAGGACGG - Intergenic
1077204557 11:1336366-1336388 GGGCAGGGGAGGTGGGAGGAGGG - Intergenic
1077204664 11:1336699-1336721 GGGCGGGGCGGGCGGGGGGGCGG + Intergenic
1077204676 11:1336721-1336743 GGGCGTGGAGGGCGGGGGGGCGG + Intergenic
1077204688 11:1336743-1336765 GGGCGTGGAGGGCGGGGGGCGGG + Intergenic
1077204727 11:1336816-1336838 GGGCGTGGAGGGCGGGGGGGCGG + Intergenic
1077204739 11:1336838-1336860 GGGCGTGGAGGGCGGGGGGCGGG + Intergenic
1077331950 11:1987744-1987766 GGGCGGGAAGGACGGGCAGATGG - Intergenic
1077343800 11:2037359-2037381 GGGCGGTGGGGGCGGGAGGAAGG + Intergenic
1077365083 11:2158388-2158410 AGGCTGGGCAGGCGGGTGGACGG - Intronic
1077368491 11:2170819-2170841 GGGCGGGGGAGGACGGGGGAGGG + Intronic
1077470962 11:2760268-2760290 GGACGGGGCAGGCGGGCAGGCGG + Intronic
1077516111 11:3003033-3003055 GGATGGGGATGGTGGGCGGAGGG + Intronic
1077543918 11:3160669-3160691 GGGCGGGGTGGGGGGGGGGAGGG - Intronic
1077664821 11:4098369-4098391 GGGAGGGGAGGGAGGGAGGAGGG - Intronic
1077824035 11:5784521-5784543 GGGAGGCGGAGGCGGGCAGATGG + Intronic
1078430104 11:11281813-11281835 GGTTGGGGGAGGCGGGTGGATGG + Intronic
1078826521 11:14935470-14935492 GGGCAGGGAAGGGGAGGGGAGGG + Intronic
1079923415 11:26460422-26460444 GGGGGGGGCGGGCGGGTGGAAGG + Intronic
1079995781 11:27293622-27293644 GGGAGGGGAGGGGAGGCGGAGGG + Intergenic
1080360915 11:31512785-31512807 GGCGGGGGAGGGGGGGCGGAGGG - Intronic
1080608995 11:33887811-33887833 GGGAGGCCAAGGCGGGCAGATGG - Intronic
1080656303 11:34261116-34261138 GGGGGGGGCAGGCGGGGAGATGG - Intronic
1080836271 11:35943974-35943996 GCCCGGGGAAGGCGGGAGGGAGG + Intronic
1080836288 11:35944011-35944033 GGGCGGGGACGGCGCGGCGAGGG + Intronic
1081720733 11:45286324-45286346 GGGCGGGGACGGAGGGAGGGAGG + Intergenic
1081758175 11:45559374-45559396 GGGTGGGGCAGGTGGGTGGAGGG - Intergenic
1081928345 11:46849466-46849488 GGGAGGCTGAGGCGGGCGGATGG - Intergenic
1082845342 11:57720635-57720657 GGGAGGCCAAAGCGGGCGGATGG - Intronic
1083050381 11:59771390-59771412 GGGGGGGGGAGGTGGGGGGACGG - Intronic
1083478350 11:62928076-62928098 GGGCGGGGAAGGGGGGCTGTGGG - Intergenic
1083482517 11:62958943-62958965 GGGCGGGGTTGGCGGGGGGAGGG - Intronic
1083743516 11:64723101-64723123 CGGCGGGGCGGGCGGGCGGGCGG - Exonic
1083755147 11:64788295-64788317 GGGCTGGGAAGGTGGGGGCAGGG - Intergenic
1083758277 11:64802812-64802834 GGGCGCGGGGTGCGGGCGGAGGG - Intronic
1083758344 11:64803019-64803041 GGGCGGGAGAGCCGGGAGGAGGG - Intronic
1083764831 11:64836711-64836733 GGGGGGGGGGGGTGGGCGGAAGG + Intronic
1083901096 11:65643935-65643957 GGGCGGGGATGCCAGGCTGAAGG + Intronic
1083911629 11:65713295-65713317 GGGCGGGGATGGCAGTGGGATGG - Intronic
1083913042 11:65721012-65721034 GGAGGGGGAAGGAGGGGGGAGGG - Intergenic
1083935954 11:65870249-65870271 GGCAGGAGAAGGAGGGCGGAGGG + Intronic
1084014826 11:66371970-66371992 CGGAGGGGAAGGCGGGGGTAGGG + Intronic
1084104887 11:66975003-66975025 GGGAGGGGAAGGAAGGGGGAGGG + Intergenic
1084165433 11:67373026-67373048 GGGAGGGGTAGGAGGGCGGGCGG - Intronic
1084337968 11:68472230-68472252 GGGAAGGGAAGGCGTGCAGACGG + Intronic
1084360927 11:68668067-68668089 GGGCGGGGAAGGAGGGTAGCAGG - Intergenic
1084494687 11:69497175-69497197 GGGCGGGGCGGGGGGGCGGGTGG - Intergenic
1084547102 11:69819893-69819915 GGCCTGGGGAGGCGGGAGGAGGG + Intergenic
1084569178 11:69949276-69949298 GGGCTGGGGAGGAGGGTGGAGGG + Intergenic
1084619677 11:70260991-70261013 GGGAGGCCAAGGCGGGCGGATGG - Intergenic
1084628623 11:70329984-70330006 GGGAGGCTAAGGCGGGAGGATGG - Intronic
1084680192 11:70662416-70662438 GGGCGGGGAGGGGGAGCGGCTGG + Intronic
1084707735 11:70825076-70825098 GGGCGGGGAAGCTGGGCGTGAGG - Intronic
1084745123 11:71165271-71165293 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1084928680 11:72535938-72535960 GGGAAGGGAAGGAGGGTGGAAGG + Intergenic
1084986255 11:72875570-72875592 GGCCAGGGCAGGAGGGCGGAAGG - Intronic
1085050501 11:73377683-73377705 GCGCGGGGGAGGGGGGCGGGGGG - Intronic
1085423234 11:76381161-76381183 GGGCGGGGGAGGAAGGCTGAGGG - Intergenic
1085641774 11:78197226-78197248 GGGCGGGGGAGGTGGGGGGGGGG + Intronic
1086086602 11:82961832-82961854 GGGGGTGGAAGGTGGGAGGAGGG - Intronic
1086518747 11:87646060-87646082 GGGAGGGGAAGGAAGGGGGAAGG - Intergenic
1088325234 11:108593881-108593903 GGGCGGGGAGGGTGACCGGAGGG - Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088834688 11:113567844-113567866 TGGCGGGAAAGGCTGGCAGATGG + Intergenic
1088834815 11:113568620-113568642 GGGCGGGGATGAGGGGAGGAGGG + Intergenic
1088906626 11:114159925-114159947 GGGCGGGGGAGGCGGGGGGGAGG + Intronic
1089165812 11:116475606-116475628 GGGCGGGGGAGGGGAGCGGGCGG + Intergenic
1089273343 11:117316089-117316111 GGGCGGGCATGGCGGGCCGGTGG + Exonic
1089504350 11:118953614-118953636 GGGTGGGGAAGGTGGGGGGGGGG + Intronic
1089525622 11:119094799-119094821 GGGCGGCGAAGGCGGGCGAGGGG + Exonic
1089573000 11:119422610-119422632 CTGGGTGGAAGGCGGGCGGACGG - Intronic
1089609377 11:119660929-119660951 GGGCGGGGAAGGCGTGGAGCTGG - Intronic
1089915626 11:122153006-122153028 GGGCGGGGGGTGCGGGGGGAAGG - Intergenic
1090178682 11:124674140-124674162 GGCAGAGGAGGGCGGGCGGAGGG - Exonic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1090699175 11:129279233-129279255 CGGCGGCGGCGGCGGGCGGAGGG - Intronic
1090699324 11:129279663-129279685 GCGCGAGGAGGGCGGGCGGCGGG + Intergenic
1091046543 11:132330607-132330629 GGGAGGGGAAGATGGGAGGAAGG + Intronic
1091281199 11:134382905-134382927 GGGCAGGGAAGGTGGTCGGCTGG - Exonic
1091286634 11:134411971-134411993 GGGCGGGGCGGGCGGGCGCGCGG - Intergenic
1091287309 11:134414825-134414847 TGGCAGGGAAGGCAGGGGGAGGG - Intergenic
1202814931 11_KI270721v1_random:42920-42942 GGGCGGGAAGGACGGGCAGATGG - Intergenic
1202826786 11_KI270721v1_random:92548-92570 GGGCGGTGGGGGCGGGAGGAAGG + Intergenic
1091456228 12:610154-610176 GGATGGGGAAGGCAGGAGGATGG - Intronic
1091493550 12:952921-952943 GGGAGGGGAAGGGGAGGGGAGGG + Intronic
1091747163 12:2999791-2999813 GAGCGGGGAAGGCGGGGAGCAGG - Intronic
1091788549 12:3257768-3257790 GGGAGGGGTAGGGGGGCGGCGGG + Intronic
1091789966 12:3266442-3266464 GGGCAGGGAAGGCGGGCCGTGGG + Intronic
1091888067 12:4031250-4031272 GGGCGCGGCGGGCGGGCGGGAGG - Intergenic
1092042364 12:5395894-5395916 GGGGAGGGAGGGAGGGCGGAGGG - Intergenic
1092127584 12:6085711-6085733 GGGCGGGGAGGGGGGGCGCGGGG + Intronic
1092143586 12:6200232-6200254 GGGCGGGGGCGGGGGGCGGGGGG + Intronic
1092229598 12:6769212-6769234 GGGCAGGCAAGGGAGGCGGAGGG + Intronic
1092443216 12:8527712-8527734 GGTGGGGGAGCGCGGGCGGAGGG - Intergenic
1092817350 12:12323139-12323161 GGGAGGGGAAGGGAGGGGGATGG + Intergenic
1092985247 12:13838741-13838763 GGGCGAGGAAGGGGAGTGGATGG + Intronic
1093474695 12:19542033-19542055 GGGAGGCCAAGGTGGGCGGATGG - Intronic
1093521583 12:20057641-20057663 GGGGGGGGAAGGGGGGAGGGAGG - Intergenic
1094317322 12:29148794-29148816 TGGCGGGGTAGGGGGGTGGAGGG - Intergenic
1094627154 12:32135060-32135082 GAGCGGGGAAGGGGAGGGGAGGG - Intronic
1094684932 12:32701965-32701987 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1094841186 12:34343322-34343344 CGGCAGGGGAGGCGGGGGGAGGG - Intergenic
1095440945 12:42238264-42238286 GGGCGGGGGAGGAGGGAGGGAGG + Intronic
1095753001 12:45730418-45730440 CGGCGGGGAATGCGGGCGTGCGG + Intronic
1095997830 12:48104258-48104280 GGGGGGGGGGGGGGGGCGGAGGG + Intronic
1096134415 12:49187904-49187926 GGGCGGGGCGGGGGGGCGGCGGG + Intronic
1096191696 12:49623758-49623780 GGGCGGGGACTGGGGGCGAAGGG + Intronic
1096372901 12:51083478-51083500 GGGCGGGGAGGGAGGGCGGTGGG + Exonic
1096487803 12:51995283-51995305 GGGCGGGCAAGGAGTGGGGAGGG + Intronic
1096529259 12:52233097-52233119 CGGCGGGGCGGGCGGGCAGAGGG + Exonic
1096592127 12:52667208-52667230 GGGAAGGGAAGGGGGGAGGAAGG + Intergenic
1096620758 12:52863478-52863500 GGGAGGGCAAGGCAGGAGGATGG + Intergenic
1096628067 12:52907319-52907341 GGACAGGGAAGGCGGAAGGAGGG + Intronic
1096983618 12:55743133-55743155 GGGCGGGGCGGGCGGGCGGCCGG - Intergenic
1097166447 12:57088937-57088959 GGGCCGGGGAGGCGGGCGCTGGG - Exonic
1097195023 12:57238413-57238435 GGGCGGGGGAGCGGGGCTGACGG + Intronic
1097938651 12:65279411-65279433 GCGCAGGGAGGGCGGGCGGCGGG - Intronic
1097990265 12:65825602-65825624 GCCCGGGGAAGGCGGGAGGTGGG + Intronic
1098279165 12:68845932-68845954 GGTCGGGGGAGGTGGGGGGAAGG - Exonic
1098312115 12:69158775-69158797 GGGCGGGGGGGGAGGGCGGCGGG - Intergenic
1098802426 12:74978421-74978443 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1100003714 12:89867825-89867847 GGACGGGGCAGCCGGCCGGAAGG + Intergenic
1100275619 12:93069171-93069193 TGGCGAGGAAGGCGGGTGGGAGG + Intergenic
1100391340 12:94148486-94148508 GGGCGTGGAGGGAGGGCGGGCGG + Intergenic
1100519126 12:95356757-95356779 GGGAGGCCAAGGTGGGCGGATGG + Intergenic
1100676639 12:96875841-96875863 GGGCGGGGGCGGCGGGAAGAGGG + Intergenic
1100877192 12:98975004-98975026 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101371054 12:104130917-104130939 GGGTGGGGAGGGCAGGCGGTGGG + Intronic
1101443704 12:104722240-104722262 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1101504178 12:105330972-105330994 GGGCGGGAGAGGCGGCGGGAAGG + Intronic
1101606000 12:106248010-106248032 GGGCCGAGGAGGCGGGAGGAGGG + Intronic
1101640233 12:106581954-106581976 GGGTGGGGAGGGCAGGGGGAGGG + Intronic
1101927996 12:108989312-108989334 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1102084375 12:110124245-110124267 GGGCGGGGAGGACGGGCGCGGGG - Intergenic
1102139608 12:110603901-110603923 GGGAGGCCAAGACGGGCGGATGG - Intergenic
1102456118 12:113071759-113071781 GGGCCGGAGAGGCGGACGGATGG + Intronic
1102561923 12:113768459-113768481 GGGAGGCTGAGGCGGGCGGATGG + Intergenic
1102883894 12:116507438-116507460 GGGAGGGCGAGGCAGGCGGATGG + Intergenic
1102928745 12:116846527-116846549 GGGAGGCGAAGGCAGGAGGATGG - Intronic
1103078149 12:118001560-118001582 GGGAGGCCAAGGCGGGAGGAGGG - Intergenic
1103238909 12:119397797-119397819 GGGTGGGGAAGGGGGGAGGGAGG + Intronic
1103291892 12:119853516-119853538 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1103363951 12:120369170-120369192 GCGCGGCGAAGGGGGCCGGACGG + Exonic
1103377634 12:120469319-120469341 GGGAGGGGAGGCCGGGGGGAGGG + Intronic
1103381268 12:120496046-120496068 GGGCGGGGCCGGCGGGAGCAGGG + Intronic
1103410795 12:120710380-120710402 CGGCGGGGAAGGGGCGGGGAGGG - Intergenic
1103425457 12:120830292-120830314 GGAGGGGGAAGGAGGGGGGAGGG + Intronic
1103432988 12:120904006-120904028 GGGCCGGGAAGGCGGCTGGCGGG + Exonic
1103576161 12:121878912-121878934 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1103705166 12:122867399-122867421 GGGTAGGGAAGGGGGGCGGTAGG + Exonic
1103728844 12:123012836-123012858 GGGCATGGAAGGAGGGTGGAGGG + Intronic
1103938389 12:124488781-124488803 GGGCAGAGAAGCAGGGCGGACGG + Intronic
1103953885 12:124566429-124566451 GGGAGGGCACGGCGGGCGGGAGG - Intronic
1103968334 12:124654143-124654165 GGGAGGCCAAGGCGGGCGGATGG + Intergenic
1104009220 12:124917370-124917392 GGGCGGGATTGGCAGGCGGAAGG + Intergenic
1104281391 12:127381210-127381232 GGGAGGGGAGGGCGCGCGGCCGG + Intergenic
1104626676 12:130362217-130362239 GGGGGTGGAAGGTGGGAGGAGGG - Intronic
1104768695 12:131346609-131346631 GGGAGGGGCTGGCGGGCGGCTGG - Intergenic
1104854120 12:131894335-131894357 GGGCGGGGAAGGGGCGGGGAAGG + Intergenic
1104854124 12:131894346-131894368 GGGCGGGGAAGGGGCGTGGAAGG + Intergenic
1104857672 12:131909588-131909610 GGGCGGGGAGGGGGCGCCGACGG - Intronic
1104916435 12:132267223-132267245 GGGCGGGGAAGGAGGCAGGCAGG + Intronic
1104961208 12:132489562-132489584 GGGCGGGGAGGACCGGGGGAGGG - Exonic
1104983351 12:132583496-132583518 AGGCGGGGGCGGCGGGCGGCAGG - Exonic
1105007316 12:132729483-132729505 GGGAGGGGAAGGTGAGAGGAGGG + Intronic
1105526283 13:21180722-21180744 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
1105578620 13:21674368-21674390 GGGCCGCGGAGGCGGGCGGAGGG + Intronic
1105578881 13:21675464-21675486 GCGCGGGGAGGGCGGAGGGAGGG + Intronic
1106248397 13:27967049-27967071 GGGCCGGGAAGGGGGCGGGAGGG - Intronic
1106526392 13:30544445-30544467 GGGGAGGGAAGAGGGGCGGAAGG + Intronic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107584239 13:41826767-41826789 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1107767840 13:43756476-43756498 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1107888799 13:44896293-44896315 GGGTTGGGAGGGCGGGAGGAAGG - Intergenic
1107910162 13:45098338-45098360 GGGAGGGCAAGGCAGGCAGACGG + Intergenic
1108006706 13:45954225-45954247 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1108192775 13:47959472-47959494 GGGCGGAGGAGGAGGGGGGAAGG + Intronic
1108408020 13:50124329-50124351 GGGCGGGGACTCCGGGCGGCGGG + Intronic
1110630316 13:77698599-77698621 GAGCGGGGGCGGGGGGCGGACGG + Intronic
1111329323 13:86743424-86743446 GGGAGGCCGAGGCGGGCGGATGG + Intergenic
1111504831 13:89174172-89174194 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
1111580922 13:90222493-90222515 GGGCGGGGGAGGGGGGCTGGGGG + Intergenic
1111927384 13:94478147-94478169 GGGTGGGGGGGGCGGGCGGGGGG - Intronic
1111951553 13:94712588-94712610 GGGTGGGGAAGGCGGGGAGGTGG + Intergenic
1111951792 13:94713578-94713600 GGGAGGGGGCGGGGGGCGGAGGG - Intergenic
1112068268 13:95818065-95818087 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1112070650 13:95846057-95846079 GGGAGGGCAAGGCAGGCGGCTGG + Intronic
1112077376 13:95928827-95928849 GGGAGGGCAAGGCAGGCGGCTGG + Intronic
1112352333 13:98646637-98646659 GGGCGGGGAAGGGTGGTGGCAGG - Intergenic
1112362473 13:98730247-98730269 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1112362479 13:98730258-98730280 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1112362485 13:98730269-98730291 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1112362491 13:98730280-98730302 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1112507071 13:99981703-99981725 GGCAGGGGAGGGCGGGCGGGAGG - Intergenic
1113039195 13:106085712-106085734 GGGTGGGGAGGGGGGGCGGGGGG + Intergenic
1113082882 13:106535767-106535789 GGGAGGGGATGGCGGACGGACGG - Intergenic
1113346698 13:109485314-109485336 GGGCAGGGGCGGCGGGCGGGGGG - Intergenic
1113417340 13:110138492-110138514 GCGCGGGGCAGGCGGGCGGGCGG + Intergenic
1113605999 13:111606698-111606720 GGGCAGGGAAGGGGAGGGGAGGG - Intronic
1113735797 13:112678478-112678500 AGACGGGGAGGCCGGGCGGAGGG + Intronic
1113841575 13:113364198-113364220 GGGGGGGCAGGGCGGGGGGAGGG + Intergenic
1113975642 13:114225556-114225578 GGGAGGGGAGGGAGGGGGGATGG + Intergenic
1114073215 14:19131814-19131836 GGGCGTGGAAGGCGGGGGCCAGG + Intergenic
1114089051 14:19268169-19268191 GGGCGTGGAAGGCGGGGGCCAGG - Intergenic
1114491653 14:23106183-23106205 GGCCGGGGGAGGCGGGGGGAGGG - Intergenic
1114633208 14:24172683-24172705 GGGTGGGGAAGGTGGGAGAATGG - Intronic
1115106091 14:29763415-29763437 GGGAGGGGAAGGGAGGGGGAGGG + Intronic
1115120084 14:29927902-29927924 GGGCGGGGAAGGGGAGCTGGGGG + Intronic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115498272 14:34027411-34027433 GGGAGGGGAAGGGGAGGGGAGGG + Intronic
1116501939 14:45634473-45634495 GGGAGGGGAAGGGGGAGGGAAGG - Intergenic
1116897921 14:50335189-50335211 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1117298927 14:54404817-54404839 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1117383368 14:55187554-55187576 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1117401108 14:55358966-55358988 GGGATGGGAAGGAGGGAGGAAGG + Intronic
1117478123 14:56118178-56118200 GGGCGGGGAGTGGGCGCGGACGG + Intronic
1117679350 14:58187284-58187306 GGGAGGCCGAGGCGGGCGGATGG - Intronic
1117690340 14:58299190-58299212 GGGAGGGGGCGGGGGGCGGAGGG - Intronic
1117898610 14:60511115-60511137 GGGCGGGCACTACGGGCGGAGGG + Exonic
1117920609 14:60723023-60723045 GGGCGGCGGAGGCGGGGGGCGGG - Intronic
1118317159 14:64732368-64732390 GGGCAGGGAAGGCCGGCACATGG + Intronic
1118339158 14:64880050-64880072 GGGTGGGGAAGGCGGGGGCTGGG - Intergenic
1118671774 14:68136334-68136356 GGGAGGCCAAGGCGGGCGGGTGG + Intronic
1118733022 14:68682679-68682701 GGGCGGGGAGGGCGGGGGAAGGG - Intronic
1118854606 14:69611527-69611549 GGGCGGGGAAGGGGCGGGAAAGG - Intergenic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119716680 14:76864415-76864437 GGGGGGGGGTGGCGGGGGGAAGG + Intronic
1120193286 14:81459009-81459031 GGGAGGGTAAGGCGGGAGAATGG - Intergenic
1120993557 14:90398109-90398131 GGGCGGGGGGGGGGGGCGGCGGG + Intronic
1121367984 14:93332520-93332542 GGGCGGGGAGAGCGGCCCGAGGG - Intronic
1121691330 14:95879077-95879099 GGACAGGGAAGGTGGGCTGAAGG + Intergenic
1121751752 14:96363420-96363442 GGCCGCGGAAGGCGGGCAGAAGG + Exonic
1121955687 14:98210524-98210546 GGGCGAGGAAGGCGGGGGAGGGG + Intergenic
1122214512 14:100193971-100193993 GGGGTGGGAAGGCAAGCGGAGGG + Intergenic
1122221280 14:100240190-100240212 GGGCGGAGACGGCCGGGGGAGGG + Intronic
1122418334 14:101560834-101560856 GCGCGCGGGAGGCGGGCGGGCGG + Intergenic
1122418489 14:101561325-101561347 GGCGGGCGCAGGCGGGCGGAGGG - Intergenic
1122540536 14:102495554-102495576 GGGTGGGGAGGCCGGGCGGCTGG + Intronic
1122658490 14:103279048-103279070 GGCGGGGGAGGGCGGGAGGAAGG - Intergenic
1122880763 14:104689588-104689610 GGGCGGGCGGGGCGGGCGGGAGG - Intronic
1122905689 14:104800585-104800607 CGGCGGGGAGGGCGCGGGGACGG - Intronic
1122961133 14:105093989-105094011 GGGCGGGGAAGGCTGGGGCGGGG + Intergenic
1123004503 14:105314835-105314857 GGGCGGGCCGGGCGCGCGGAGGG - Exonic
1123024981 14:105420163-105420185 GGGCCGCGAGGGCGGGCGGGGGG - Intronic
1123047621 14:105526550-105526572 GGGCGGGGGAGGGGCGCGGCGGG + Intergenic
1124607133 15:31178165-31178187 GGGCGGGGAGTGGGGGAGGAAGG - Intergenic
1124838994 15:33224290-33224312 GGGCGGGGAGGGCGGGGGGAAGG + Intergenic
1124966480 15:34436582-34436604 GTGCGGGGAACGCCCGCGGAGGG - Intronic
1125200982 15:37100572-37100594 GGGTGGGGGAGGCGGGGGGGCGG + Intronic
1125535846 15:40441014-40441036 GGGCGGGGCAGGCAGCCGGACGG - Intronic
1125716297 15:41821776-41821798 GGGAGGGGAAGACGGGGGCACGG - Intronic
1125725038 15:41863859-41863881 GGGCCGGGAAGAGGGGTGGAAGG - Intronic
1126034886 15:44536941-44536963 GGGGGGCGGAGGGGGGCGGAGGG - Intergenic
1126099678 15:45111742-45111764 AGGCGGGGAAGGCGGCGGGAAGG - Intronic
1126103854 15:45135295-45135317 AGGCGGGGAAGGCGGCGGGAAGG + Intronic
1126402960 15:48293146-48293168 GGGAGGATAAGGCGGGCAGATGG - Intronic
1126628778 15:50712656-50712678 GGGGGGGGAGGGAGGGAGGAAGG - Intronic
1127558284 15:60109856-60109878 GGGGGGCCAAGGTGGGCGGAGGG + Intergenic
1127606605 15:60592773-60592795 GCGAGGGGAAGGCGGGCGCCCGG - Intronic
1127674766 15:61228814-61228836 GGGCGGGGGAGGCGGCGGGAAGG - Intronic
1127920483 15:63490553-63490575 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1127985610 15:64068027-64068049 GGGAGGCCAAGGTGGGCGGATGG - Intronic
1128456399 15:67833957-67833979 CCGGGAGGAAGGCGGGCGGACGG - Exonic
1128582698 15:68820216-68820238 AGGCGCGGGAGGGGGGCGGAAGG + Intronic
1128797874 15:70478320-70478342 GGGCAGGGCAGGCGCCCGGAGGG - Intergenic
1128987168 15:72230337-72230359 GTCCGGGGCGGGCGGGCGGAGGG - Intronic
1129326092 15:74800931-74800953 GGGCGGGGTAGGGGGGAGGTTGG + Intronic
1129518314 15:76170468-76170490 GGCTGGGGCAGGCGGACGGAAGG + Intronic
1129678794 15:77646423-77646445 GGGCAGGGAAGGCGAGAAGAGGG + Intronic
1129715936 15:77850862-77850884 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1129933020 15:79428172-79428194 GGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1130393962 15:83485734-83485756 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1130531092 15:84748460-84748482 GGGGGGGGGGGGCAGGCGGAAGG - Intergenic
1130916484 15:88309156-88309178 GGGAGGGTGAGGCGGGAGGATGG - Intergenic
1131122645 15:89832203-89832225 GGGAGGCCAAGGCGGGAGGATGG + Exonic
1131203250 15:90418905-90418927 GGGAGGGTAAGGCAGGTGGATGG + Intronic
1131641145 15:94295187-94295209 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1131846504 15:96494965-96494987 AGGCGGGGCAGGCAGGGGGAGGG + Intergenic
1131972144 15:97903632-97903654 GGGCGGGGAAGGAGGCAGGGGGG + Intergenic
1132273239 15:100544606-100544628 GTGCGGGGACGGCAGGTGGAGGG - Intronic
1132357786 15:101185547-101185569 AGGCGGGGAAGGGGGATGGAGGG - Intronic
1132365100 15:101251503-101251525 GGGCGGGGGCAGCGGGCTGAGGG - Exonic
1132515567 16:364228-364250 GGGCGGGGTGGGCGTGGGGAGGG + Intergenic
1132519875 16:382050-382072 GGGCGCGGACGCCGGGGGGAGGG + Intronic
1132550957 16:553668-553690 GGGAGGGGAAGGAGGGGGGCGGG - Exonic
1132591566 16:728451-728473 GGGCGGGGCCGGCGGGAGGCGGG - Intronic
1132614342 16:832779-832801 GGGCGGGGCGGGGTGGCGGATGG - Intergenic
1132641814 16:981595-981617 GGGCGGGGCAGGCGGGGGCGCGG + Intergenic
1132677432 16:1126574-1126596 GTGGGGGGAGGGCGGGGGGAGGG - Intergenic
1132880716 16:2160608-2160630 GGGAGGGGTAGGGGGGCTGATGG + Intronic
1133020223 16:2963917-2963939 AGGCGGGGCAAGCGGACGGAAGG - Intergenic
1133220877 16:4318693-4318715 AGGCCGGGAAGGAGGGTGGAGGG - Intronic
1133223055 16:4327549-4327571 GGCCGGGGACTGCGGGCGGGGGG + Intronic
1133250325 16:4476517-4476539 GGTCCGAGAAGCCGGGCGGAAGG - Intronic
1134167360 16:11941363-11941385 GGGAGGGGAAGGGGAGAGGAAGG + Intronic
1134241918 16:12512885-12512907 GGACTGGGAAGGAGGGAGGAGGG - Intronic
1134493332 16:14712318-14712340 GGGAGGGGAAGGGGAGGGGAAGG - Intronic
1134498713 16:14751442-14751464 GGGAGGGGAAGGGGAGGGGAAGG - Intronic
1134525267 16:14938072-14938094 GGGAGGGGAAGGGGAGGGGAAGG - Intronic
1134547619 16:15122825-15122847 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1134547625 16:15122836-15122858 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1134547630 16:15122847-15122869 GGGAGGGGAAGGGGGGAGTAAGG + Intronic
1134712855 16:16336556-16336578 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1134799599 16:17071745-17071767 GGGAGGGGAAGGGGAGGGGATGG - Intergenic
1134953972 16:18372137-18372159 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1135250740 16:20899822-20899844 GGGAGGGAAATGAGGGCGGAGGG + Intronic
1135312793 16:21419011-21419033 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1135365716 16:21851291-21851313 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1135446098 16:22519871-22519893 GGGAGGGGAAGGGGAGGGGAAGG - Intronic
1135529079 16:23237231-23237253 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1135603351 16:23801774-23801796 GGGAAGGGAAGGGGGGGGGAGGG - Intergenic
1135892642 16:26371450-26371472 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1136129742 16:28212044-28212066 GAGCGGGGGGAGCGGGCGGAGGG + Intergenic
1136168197 16:28470611-28470633 GGGAGGGGAAGGGGAGGGGAGGG + Intronic
1136168209 16:28470633-28470655 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1136180230 16:28546716-28546738 GGGAGGCCAAGGCAGGCGGATGG + Intergenic
1136184221 16:28576249-28576271 GGGCGGGGAGGGTAGGAGGAGGG + Intronic
1136226275 16:28862855-28862877 GGGAGGCCGAGGCGGGCGGATGG - Intronic
1136229904 16:28879973-28879995 GGGCGGGGCAGGGGCGCCGACGG - Intronic
1136233174 16:28899637-28899659 GGGGGGGGGGGGCGGGCGCAGGG - Intronic
1136255859 16:29038495-29038517 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1136322906 16:29499519-29499541 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1136365007 16:29805977-29805999 GCGCGGGGAGGGCGGGCGGGGGG - Intergenic
1136437590 16:30239487-30239509 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1136556562 16:31010658-31010680 GCGCGGGGGAGGGGGGCGGAGGG + Intergenic
1136702231 16:32154764-32154786 GGGCGGGGGAGGTGGGCGGGTGG - Intergenic
1136765438 16:32772721-32772743 GGGCGGGGGAGGTGGGCGGGGGG + Intergenic
1136802661 16:33097658-33097680 GGGCGGGGGAGGTGGGCGGGGGG - Intergenic
1137394881 16:48109908-48109930 GGGCGGTGAAAGCTGGAGGAAGG - Intronic
1137401365 16:48156447-48156469 GGGCAGGGGAGGCGAGGGGAGGG + Intergenic
1137655384 16:50154041-50154063 CGGCGGGGACGGCGGCCGAAGGG - Exonic
1137728624 16:50673669-50673691 GGGCCGGGACGGCGGCCGCAGGG + Exonic
1137824082 16:51474968-51474990 GGGAGGGGAAGGGAGGGGGAAGG - Intergenic
1137988506 16:53130601-53130623 GGGCGGGGAAGGCTTGGGGCCGG - Intronic
1138496937 16:57414634-57414656 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1138528790 16:57623657-57623679 GGGTGGGGGAGGCGGGCCTAGGG + Intronic
1138539482 16:57679742-57679764 GGGCAGGGGAAGCGGGAGGACGG - Intronic
1138567993 16:57847291-57847313 GGGCGGGGAGGGAGGGAGGGAGG + Intronic
1138591214 16:58000626-58000648 GCGCCGGGAGGGCGGGCGGACGG + Intronic
1138618083 16:58188036-58188058 GGGTGGGGAAGGGGAGGGGAGGG + Intronic
1138667749 16:58586361-58586383 GGGAGGGGAGGGCAGGGGGAGGG + Intronic
1138708517 16:58942414-58942436 GGGCGGGGGAGGCGGGGGAGGGG - Intergenic
1139215513 16:65122133-65122155 GGGCGGGGGGGGCGGGAGGAGGG + Exonic
1139364511 16:66425684-66425706 GGGCGGGGAGTGGGGGCGGGGGG + Intergenic
1139364853 16:66427096-66427118 GCGCGGGGACGACGGGCGGCCGG + Intergenic
1139467121 16:67159947-67159969 GGGCGGGACGCGCGGGCGGACGG - Exonic
1139475052 16:67199017-67199039 GGGCGGGGAGGGCAGGCTGCCGG - Intergenic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1139749478 16:69100588-69100610 GAGCAGGGGAGGCGGGAGGAGGG - Intergenic
1139857147 16:69990140-69990162 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1140207784 16:72947712-72947734 GGGTGGGGAAGGGGTGAGGAAGG + Intronic
1140221623 16:73048160-73048182 GCCCGGGGAAGGGGGGCGGGCGG + Exonic
1140462223 16:75148843-75148865 GGGCGGGGACGGCGGAGGGAAGG + Intronic
1140784414 16:78326567-78326589 GGGGGGGGGGGGCGGGGGGAGGG - Intronic
1140850090 16:78927033-78927055 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1141054638 16:80804079-80804101 GGGCGGCGGCGGCGGGCGGCGGG - Intronic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141427161 16:83951947-83951969 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141427202 16:83952055-83952077 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141531607 16:84649956-84649978 GGGCGGGGGAGGCAGGGGGAGGG - Intronic
1141557581 16:84846206-84846228 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
1141571317 16:84935378-84935400 GGGAGGCCAAGGCGGACGGATGG - Intergenic
1141682941 16:85554776-85554798 GGGGGGGGAGGGAGGGAGGACGG + Intergenic
1141703568 16:85653181-85653203 GGGGGGAGGAGGGGGGCGGAGGG - Intronic
1141804869 16:86335944-86335966 GGCCGGGGAGGGTGGGTGGAGGG - Intergenic
1141910730 16:87056854-87056876 GGCCGGGTAGGGCGGGAGGAGGG + Intergenic
1141952005 16:87345317-87345339 GTGCGGGGAGGGCGGGAGGCAGG + Intronic
1141989569 16:87602428-87602450 GGGCGGGGGCGGGGGGCGGGGGG + Intronic
1142156743 16:88535786-88535808 GGGCAGGGAAGACGGGGGGTGGG - Exonic
1142158972 16:88547312-88547334 GGGTGGGGAAGGCGAGGAGAGGG + Intergenic
1142228661 16:88889274-88889296 GGCGGAGGAAGGCGGGAGGAGGG + Intronic
1142251472 16:88993847-88993869 GGGAGGGGAAGAAGGGAGGAGGG - Intergenic
1142289725 16:89188009-89188031 GGGAGGGGAGGGTGGGCTGAGGG + Intronic
1142317202 16:89355253-89355275 AGGCTCGGAAGGCGGGCAGAGGG + Intronic
1142317211 16:89355287-89355309 AGGCTCGGAAGGCGGGCGGACGG + Intronic
1142375060 16:89702206-89702228 CGGCACGGAAGGTGGGCGGAAGG + Intergenic
1203067824 16_KI270728v1_random:1034943-1034965 GGGCGGGGGAGGTGGGCGGGTGG + Intergenic
1142550085 17:732843-732865 GGGCGGAAAAGGGGGGCGGCAGG + Intronic
1142586993 17:979903-979925 GCGTGGCGAGGGCGGGCGGAGGG - Intergenic
1142707016 17:1701757-1701779 GGGGGAGGGGGGCGGGCGGAGGG + Intergenic
1142795326 17:2303239-2303261 GGCCGGGGCAGGCCCGCGGAGGG + Intronic
1142810280 17:2392856-2392878 TGGCCGGGAGGGCGGGCGGAAGG + Intronic
1142837643 17:2600332-2600354 GGGAGGCCAAGGCGGGCAGAAGG + Intronic
1142854868 17:2723967-2723989 GGGTGGGGGAGGCGGGGGGTGGG + Intergenic
1142859970 17:2755591-2755613 GCGCGGGGAGGGCGCGGGGAGGG - Intergenic
1142859975 17:2755602-2755624 GCGCGGGGAGGGCGCGGGGAGGG - Intergenic
1142884449 17:2903972-2903994 GGGCTGGGAAGAGGGGCAGAAGG + Intronic
1142958149 17:3535161-3535183 GGAGGAGGAAGGAGGGCGGAGGG - Intronic
1143030487 17:3964525-3964547 GGGCGCGGAGGGCGGCCGGAAGG - Intergenic
1143062942 17:4218505-4218527 GGGAGGCCAAGGTGGGCGGATGG + Intronic
1143162586 17:4881269-4881291 GGGGAGGGAAGGCGGGCAGGGGG - Intronic
1143283387 17:5771481-5771503 GGTCGGGGCGGGCGGGGGGAGGG - Intergenic
1143289266 17:5816699-5816721 GGGCTGGGAATGCTGGCGCATGG + Intronic
1143473823 17:7192007-7192029 GGGCAGGCAGGGTGGGCGGAGGG + Intronic
1143512627 17:7404850-7404872 GGGCGGGGGAGGCGGCCGCGCGG + Intergenic
1143514762 17:7414123-7414145 CCGCGGGGAAGGCTGGCAGAGGG + Intronic
1143524141 17:7462679-7462701 GGGCAGGTAAAGCGGGTGGAGGG + Exonic
1143539810 17:7562238-7562260 GAGCGGGGAAGCCGGGCGGACGG - Exonic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1143663283 17:8340512-8340534 GGGCTGGGATGGGGGGTGGAGGG - Intronic
1144457347 17:15430087-15430109 GGTGGTGGATGGCGGGCGGAGGG - Intergenic
1144561002 17:16320276-16320298 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1144647868 17:16987679-16987701 GGGCGGGGCAGGGGGTAGGAAGG - Intergenic
1144934993 17:18890549-18890571 GGGAGGGTAAGGCGGGTGGGTGG - Intronic
1145018399 17:19413154-19413176 GGGCGGGGCAGGAGGGAGGCGGG + Intronic
1146132555 17:30291720-30291742 CGGCGGGGAAGGCCGGGGGCTGG - Intronic
1146901367 17:36591769-36591791 GGGCGGGGCAGAGGGGCGGAAGG + Intergenic
1147119155 17:38325454-38325476 GGGCGGGGAGGGGTGGGGGAGGG + Intergenic
1147177364 17:38664213-38664235 GGGCGGGGTCGGCGGGGAGAAGG - Intergenic
1147288955 17:39426025-39426047 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1147323556 17:39659734-39659756 GTGCGGGGAAGGGGGGCCAAGGG - Intronic
1147373536 17:40010720-40010742 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1147393139 17:40122230-40122252 GGGCGGGGAAGGGGGGGTGCGGG + Intergenic
1147598834 17:41733752-41733774 GGGGTGGGTGGGCGGGCGGAGGG - Intronic
1147839571 17:43361763-43361785 CGGAGGGGAAGGGAGGCGGAGGG - Intergenic
1147966957 17:44199143-44199165 GGGCGGGGAAGGAGAGGGGCTGG - Intronic
1147970792 17:44218567-44218589 GGGTTGGGAAGCGGGGCGGAGGG - Intronic
1148048738 17:44759134-44759156 GCGCGGGGAGGGCGGGAGCAGGG - Exonic
1148082986 17:44977696-44977718 GGGCGGGGATGGAGGGCTGCTGG + Intergenic
1148105244 17:45115293-45115315 AGGGGGGGAAGGTGGGAGGACGG - Intronic
1148146414 17:45367708-45367730 GGGTGGGGCAGGCGGGGAGAGGG + Intergenic
1148244191 17:46019770-46019792 GGGAGGCGAAGGTGGGCAGATGG + Intronic
1148262123 17:46193129-46193151 CGGCCGGGAGGGCGGGCGGGCGG + Intronic
1148323795 17:46771953-46771975 CGGCGGGGTCGGCGGCCGGAAGG - Intronic
1148354797 17:46968685-46968707 TGGTGGGGAAGGCAGGCAGAGGG - Intronic
1148432209 17:47650784-47650806 GGGCGGGGGAGTCGGGCCTAGGG + Intronic
1148470187 17:47888459-47888481 GGGAGGCTGAGGCGGGCGGATGG - Intergenic
1148615536 17:48997575-48997597 GGGCGGGGAAGGCGGCCTGAGGG - Exonic
1148679477 17:49465537-49465559 GGGCGGGGAAGCTGGACGGAAGG - Intronic
1148751500 17:49948088-49948110 GGGCGGGGAAGCCCTGAGGATGG - Intergenic
1148836770 17:50469655-50469677 GGGCGATGAAGGAGGGGGGATGG - Intronic
1148960068 17:51385361-51385383 GTGAGGGGAAGGATGGCGGATGG - Intergenic
1149315130 17:55431857-55431879 GGGAGGGGAGGGCAGGGGGAGGG + Intergenic
1149315164 17:55431922-55431944 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1149315173 17:55431938-55431960 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1149793520 17:59499817-59499839 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
1150060573 17:62065345-62065367 GGGTGGGGAGGGCGGGCGCCCGG - Intergenic
1150488262 17:65558980-65559002 AGGCGGGGAAGGTGAGAGGAAGG + Intronic
1150552232 17:66221366-66221388 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1150722828 17:67628140-67628162 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1150820130 17:68428135-68428157 GGGAGGCCAAGGAGGGCGGATGG - Intronic
1150826319 17:68478965-68478987 GGGAGGCCAAGGTGGGCGGATGG - Intergenic
1151144377 17:72027249-72027271 GGGGAGGGAATGCGGGAGGATGG - Intergenic
1151218376 17:72592873-72592895 GGGCGGGGAGGGGGTGGGGAAGG + Intergenic
1151490830 17:74431557-74431579 GCGCGGGGTAGTCGGGCCGAGGG + Exonic
1151599487 17:75097525-75097547 GGGCTGGGAAGGTGGTGGGAGGG + Intronic
1151747906 17:76021613-76021635 GGGCGGGGAAGGGGGGAGGTGGG - Intronic
1151798495 17:76362965-76362987 GGGAGGCCAAGGCGGGCGGATGG + Intronic
1151821556 17:76499789-76499811 GGGCTGGGAGGGTGGGCAGAGGG - Intronic
1151849962 17:76684463-76684485 GGGCGGGGAAGGGGTGCGCTGGG - Intronic
1151919298 17:77141323-77141345 GGGCGGGGGAGGGGGGCGAGGGG - Intronic
1152013651 17:77735767-77735789 GGGCGGGGAGGGAGGGAGGGAGG - Intergenic
1152037003 17:77879737-77879759 GGGCGGGGAAGGAGAGGTGATGG - Intergenic
1152077541 17:78168720-78168742 GCCCGGGGAGGGCGGGCCGAGGG + Intronic
1152268614 17:79310646-79310668 GGCTGGGGAATGCGGGAGGAGGG - Intronic
1152362350 17:79838714-79838736 GAGCCGGGGAGGCCGGCGGAGGG - Intronic
1152396586 17:80036686-80036708 GGGCCGGTAAGCCGGGCCGAGGG + Exonic
1152524413 17:80879389-80879411 GGGCAGGGCAGGCGGGGGCAGGG - Intronic
1152587227 17:81194491-81194513 GGCAGGGGCAGGCAGGCGGATGG - Intronic
1152597009 17:81242645-81242667 GGGGGGGGGAGGCGGGGGGGAGG + Intergenic
1152609254 17:81307528-81307550 GGAAGGGGAAGGGGGACGGAAGG - Intergenic
1152625698 17:81387039-81387061 GGGCGCGGAGGGAGGGCCGAGGG + Intergenic
1152639785 17:81444696-81444718 AGGCGGGGAAGCCGGGGGGCAGG - Exonic
1152690555 17:81715966-81715988 GGGAGGGGCGGGCGGGCCGAGGG - Intronic
1152718574 17:81911500-81911522 GGGCGGGGGAGGCGGGGGCGGGG - Intergenic
1152793255 17:82293289-82293311 GGGAGGGGAGGGCGCGGGGAGGG + Intergenic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1153007747 18:512653-512675 GGGCGGCCAAGGCAGGCGGCTGG + Intergenic
1153027209 18:682627-682649 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1153031180 18:713531-713553 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1153196537 18:2604441-2604463 GGGAGGCCAAGGCGGGTGGATGG + Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153457236 18:5295289-5295311 GGGCGGGGGCGGCGCGCGGCCGG + Intronic
1153636628 18:7118030-7118052 GGGCAGAGAAGGTGGGCTGAGGG + Intergenic
1153805367 18:8705508-8705530 GGGCGGGGACGGCGGGAGCGCGG + Intergenic
1153900538 18:9614331-9614353 GCGGGGGGGAGGCGGGCGGGGGG - Intronic
1154161070 18:11981315-11981337 GGGCGGGGAAGAGGGGGGAATGG + Intronic
1155213667 18:23623543-23623565 GGGGGGCCAAGGCGGGAGGATGG + Intronic
1155313689 18:24549958-24549980 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
1156350363 18:36297470-36297492 GGGCGGGGAGGCCGGGCGGCCGG - Intergenic
1157085192 18:44573384-44573406 GGGAGGGGAAGAAGGGAGGAAGG + Intergenic
1157152657 18:45233748-45233770 GGGCGGGGGAAGCGGGGGGTGGG - Intronic
1157196837 18:45626596-45626618 GGGTGGGGAAGGTGGGGGGGTGG - Intronic
1157222491 18:45837934-45837956 GGGCGGGGCAGGCGGGAGGGCGG - Intronic
1157738412 18:50071061-50071083 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1158202233 18:54954006-54954028 GGGAAGGGAAGGCGAGGGGAGGG - Intronic
1158357647 18:56638626-56638648 GGGCGGGGAGGGATGGGGGAGGG + Exonic
1159184475 18:64950579-64950601 TGGCGGGGCAGGGGGGCGGGGGG + Intergenic
1159770398 18:72541776-72541798 GGGCGGGGTGGGCAGGCCGACGG + Intronic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1160163268 18:76491402-76491424 GGGCGGGCGGGGCGGGCGGGGGG - Intronic
1160164292 18:76496143-76496165 GGGAGGGGAGGGCGGGCGCGCGG + Intronic
1160693398 19:470711-470733 GGGCTGGGAGCGCGGTCGGAAGG - Intronic
1160736083 19:663015-663037 GGGCCGGGGCGGCGGGCGGCAGG - Intronic
1160851019 19:1192603-1192625 GGGCGTGGAGGCCGGGCGCAGGG + Intronic
1160859011 19:1229839-1229861 GGGCGGGGAGGGCGGCGGGAAGG + Exonic
1160937825 19:1605490-1605512 GCGCGGGGAGGGCGGGGGGGGGG + Exonic
1160965666 19:1746014-1746036 GGAGGGGGAAGGAGGGGGGAAGG + Intergenic
1161001733 19:1914205-1914227 GGAGGTGGCAGGCGGGCGGAGGG + Intronic
1161063594 19:2227145-2227167 GGGCCGGGGCGGGGGGCGGACGG - Intronic
1161065704 19:2236281-2236303 GAGCGGGGACGGCGGCCGGGAGG - Exonic
1161139348 19:2638466-2638488 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1161139355 19:2638477-2638499 GGGAGGGGAAGGGGAGGGGAGGG + Intronic
1161139612 19:2639749-2639771 GGGGGAGGAAGGAGGGGGGAAGG + Intronic
1161139853 19:2640866-2640888 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1161252036 19:3285664-3285686 GGGCGGGGAAGGGGGGGTGGGGG - Intronic
1161338198 19:3725981-3726003 GGAGTGGGAAGGCGGGTGGAGGG - Intronic
1161400760 19:4065619-4065641 GCGTGGGGGAGGCGGGCGGGCGG - Intronic
1161471139 19:4457354-4457376 CGGCGGGGGAGGCGAGGGGAGGG - Intronic
1161592527 19:5135279-5135301 GTGTGGGGCAGGCGGGCGGGCGG - Intronic
1161628605 19:5340285-5340307 GGGCGGGGCAGAGGCGCGGAGGG - Intronic
1161846388 19:6713827-6713849 GGGTGGGGAAGGTGGGGGGCTGG - Intronic
1161959533 19:7516155-7516177 CGGCGGGGCTGGCGGGCGGGGGG + Exonic
1161979045 19:7621039-7621061 GGGCGGGGTAGGCGGGGAGAGGG + Intronic
1162111849 19:8403799-8403821 GGGTGGGGAGGGCGGCAGGATGG + Exonic
1162111861 19:8403836-8403858 AGGCGAGGAGGACGGGCGGACGG + Exonic
1162294722 19:9805414-9805436 GGGAGGCCAAGGTGGGCGGATGG + Intergenic
1162317363 19:9947731-9947753 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1162337743 19:10072027-10072049 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1162389439 19:10380473-10380495 GGGCGCGGAAGGAGCGCGGCCGG - Exonic
1162398408 19:10430960-10430982 GGGCGGCGAACGCGGGCGGCGGG - Intronic
1162401776 19:10450968-10450990 GGGCGGGGCAGGCGGGGGCGGGG + Intronic
1162402285 19:10453466-10453488 GGGCGTGGATGGCGGGCAGCTGG + Intronic
1162515798 19:11146835-11146857 GGGAGGCCAAGGCGGGCGGGTGG + Exonic
1162568440 19:11457208-11457230 GGGTGGGGAGGGCAGGCCGACGG - Intronic
1162697101 19:12484824-12484846 CCGCCGGGAAGGCGGGCGGAGGG - Intronic
1162717148 19:12641359-12641381 TGGCGGGGAAAGCAGGGGGAAGG - Intergenic
1162778600 19:12995412-12995434 GGGCGGCGCGGGCGGGAGGAGGG - Intergenic
1162954530 19:14090857-14090879 GAGGGAGGAAGGCGGGCGGCGGG - Intronic
1162954629 19:14091089-14091111 GGGCGGGCAGGGCGGGCGGGCGG + Intergenic
1163004573 19:14389281-14389303 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1163058375 19:14739859-14739881 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1163138763 19:15332323-15332345 GGGCGGCGGCAGCGGGCGGACGG - Intronic
1163304670 19:16470486-16470508 GGGCGGGGAAGGCGGGAGTCGGG - Intronic
1163471508 19:17500080-17500102 AGGCTGGGAAGGTGGGAGGAGGG + Intronic
1163535046 19:17872216-17872238 GGACGGGGAGGGCGGGTGGGAGG - Exonic
1163610686 19:18299870-18299892 GGGACGCCAAGGCGGGCGGATGG - Intergenic
1163633738 19:18429231-18429253 AGGCGGGGGAGGGGGGCGGGGGG + Intronic
1163646818 19:18494247-18494269 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1163845749 19:19637390-19637412 GGAAGGAGAAGGCGGGCGGCGGG + Exonic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164937385 19:32224825-32224847 GGGCGGGAGAGCCGGGCGGTGGG - Intergenic
1165013141 19:32863266-32863288 GGGCGGGGGAGGGGGGTGGTGGG - Intronic
1165161712 19:33820441-33820463 GGGGAGGGAGGGCTGGCGGAAGG + Intergenic
1165172922 19:33906308-33906330 GGGCGGGGAAGGCGTGGGCGGGG - Intergenic
1165198211 19:34123251-34123273 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1165420017 19:35717980-35718002 GGGCCGGGGAGGCGGGGGGAGGG - Intergenic
1165546025 19:36536818-36536840 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1165939117 19:39406626-39406648 GAGCGGGGAATGCGTGGGGAAGG - Intergenic
1165962246 19:39544855-39544877 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1166006344 19:39909942-39909964 GGGAGGCCAAGGCGGGAGGAAGG + Intronic
1166065869 19:40358632-40358654 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1166084162 19:40464331-40464353 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1166084685 19:40467077-40467099 GCGCGGGGACCGCGGGCGGGAGG + Intronic
1166189917 19:41169724-41169746 GGGAGGCCGAGGCGGGCGGATGG - Intergenic
1166214668 19:41327498-41327520 GGGCGGGGGAGGGGGCAGGAAGG + Intronic
1166257168 19:41614937-41614959 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1166288107 19:41844800-41844822 GGGCGGGCAGGACGTGCGGAGGG + Intronic
1166309052 19:41952145-41952167 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
1166375212 19:42324026-42324048 AGCCGCGGAAGGCGGGCGGTGGG - Intronic
1166677488 19:44748642-44748664 GGGGCGGGGAGGCGGGCGGCCGG + Exonic
1166704861 19:44903175-44903197 GGGCGTGGAAGGCGGGGGCCAGG - Exonic
1166762573 19:45234329-45234351 CGGCGGGGTAGGCGGGCGCCAGG + Intronic
1166799975 19:45450877-45450899 GGGGGGGGGGGGCGGGCGCACGG - Intronic
1166881113 19:45930693-45930715 GGGCTGGGAAGGGGGAAGGAGGG - Intergenic
1166982920 19:46642055-46642077 GGGCTGGGAAGGTTGGAGGATGG + Intergenic
1167002886 19:46756281-46756303 GAGCTGGGAAGGCGGGCGGCTGG + Exonic
1167017492 19:46850598-46850620 GGGCCGGGAAGGAGGGCACAGGG - Intronic
1167140093 19:47644443-47644465 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
1167177805 19:47877788-47877810 GGGAGGTGAAGGCAGGTGGATGG - Intronic
1167240824 19:48342162-48342184 GGGAGGGGAAGGGGAGGGGAGGG + Intronic
1167250778 19:48397366-48397388 AGGCGGGGAAGGCGAGTGGCAGG - Intronic
1167295332 19:48646191-48646213 GGGAGGGGGAGGAGGGAGGAAGG - Exonic
1167295447 19:48646569-48646591 GGGCGGGGAAGGGGGGCTGCGGG - Intergenic
1167417910 19:49386776-49386798 GGGAGGGGAAGGGAGGGGGAAGG + Intergenic
1167420264 19:49398606-49398628 GGGAGGATAAGGCGGGAGGATGG - Intronic
1167424465 19:49423040-49423062 GGTGGGGGAAGGCGGGAGGAGGG - Intronic
1167510018 19:49890943-49890965 GGGCGGGGCTGGCGGGCAGGGGG - Intronic
1167562419 19:50233806-50233828 GGGCGGGGGGGTCGGGGGGAGGG - Intronic
1167601455 19:50457421-50457443 TGTCTGGGAAGGCGGGCTGAGGG - Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1167622923 19:50568797-50568819 GGGAGGGGAGGGCGGGGGGCAGG + Intergenic
1167738679 19:51311708-51311730 GGGCGGCGGGGGCGGGGGGAGGG - Intergenic
1167757510 19:51421784-51421806 GGGCGGGGACGGTGGGAGGTGGG + Intergenic
1167792160 19:51689435-51689457 TGGCGGGGACGGCGGGAGGAAGG + Intergenic
1167979856 19:53265988-53266010 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1168025094 19:53638082-53638104 GGGAGGCTGAGGCGGGCGGATGG + Intergenic
1168061005 19:53892279-53892301 GGGCGGAGAATGCAGGAGGAAGG + Intronic
1168076460 19:53982974-53982996 GGGCGGGGAGGGTGGGCGTGGGG - Exonic
1168245661 19:55112172-55112194 GGGCGGGGTGGGTGGGTGGAGGG - Intronic
1168251845 19:55146316-55146338 GGGCGGGTTATGGGGGCGGAGGG + Intronic
1168282290 19:55312098-55312120 GGGCACGGAAGGGGGGTGGAGGG - Exonic
1168293114 19:55366569-55366591 GGGAGGCCGAGGCGGGCGGATGG + Intronic
1168307422 19:55442985-55443007 GGCTGGGGAGGGCGGGCGGGGGG + Intergenic
1168309047 19:55451641-55451663 GGGCGGGGGAGGCGGGGGTCCGG - Intergenic
1168449142 19:56449434-56449456 GGGAGGCCAAGGCGGGCGGGTGG + Intronic
1202694149 1_KI270712v1_random:112269-112291 GGGCGGGCCAGGCGTGCGGTGGG + Intergenic
924987896 2:288133-288155 GGGCCGGGCTGGCGGGCGGGCGG - Exonic
925068646 2:950172-950194 GGGCGGGAAGGGAGGGTGGAAGG + Intergenic
925730540 2:6917330-6917352 GGCCGGCGCAGGCGGGCGGCAGG + Intergenic
925755506 2:7128295-7128317 GGAGGGGGAAGGGGGGAGGAGGG - Intergenic
926101250 2:10119825-10119847 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
926110878 2:10183064-10183086 GGGAGGCTAAGGCGGGAGGATGG + Intronic
926130829 2:10302524-10302546 GGGCGGGGGGCGCGGGCGCAGGG + Intergenic
926198973 2:10780023-10780045 AGGCGGGGAAGGGGTCCGGAAGG - Intronic
926762448 2:16290950-16290972 GGGGAGGGAAGAGGGGCGGAAGG - Intergenic
927165922 2:20321329-20321351 GGGCTGGGAAGCGGGGGGGAGGG + Intronic
927472124 2:23384938-23384960 GGGCGGGGGCGGCGGACGGACGG + Intergenic
927596618 2:24403140-24403162 GCGGGGGAAAGGCGGGCGGGGGG - Intergenic
927631872 2:24781394-24781416 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
927742377 2:25583019-25583041 GGGAGGCCAAGGCGGGCAGATGG + Intronic
928140490 2:28724194-28724216 GGGCTGGGAGGGCAGGGGGAAGG + Intergenic
928515187 2:32038410-32038432 GGGGGGGGGGGGCGGGGGGAGGG + Intronic
928998707 2:37324792-37324814 GGACGGGGAGGGAGGGAGGAAGG - Intronic
929650901 2:43678342-43678364 GGGCGGCCAAGGCAGGCGGCTGG + Intronic
929700371 2:44157420-44157442 GGGAGGCTAAGGCGGGCGGGTGG - Intergenic
929831701 2:45352117-45352139 GGCAAGGGAAGGCGGGAGGATGG + Intergenic
929936407 2:46297319-46297341 GGGCGCGGAGGGCGGGGGGCGGG - Intronic
930136046 2:47905412-47905434 GGCCGGGGCGGGCGGGCGGGCGG - Intronic
930136068 2:47905448-47905470 TGCCCGGGAAGGCGGGCGGTTGG + Intronic
931038454 2:58269074-58269096 GGGGGGGTAGGGCGGGCGGGGGG - Intergenic
931260559 2:60614846-60614868 GGGAGGCCAAAGCGGGCGGATGG + Intergenic
931515912 2:63050649-63050671 GGGCGGGGAGGGCGGGGTGTGGG + Intronic
932028037 2:68155586-68155608 GGGAGGGAGAGGCGGGAGGATGG + Intronic
932162518 2:69474964-69474986 GGGCGGGGGTGGGGGGAGGATGG - Exonic
932288304 2:70554383-70554405 GGGCGGGGAAGGCTGGAGGCTGG + Intergenic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932887285 2:75559705-75559727 GGGCGGGGGAGTTGGGGGGACGG + Intronic
932920874 2:75914213-75914235 GAGGGTGGAAGGCGGGAGGAGGG - Intergenic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
933858586 2:86441934-86441956 CAGCAGGGAGGGCGGGCGGAGGG - Intronic
933890342 2:86762799-86762821 GGGAGGCCAAGGCGGGAGGATGG + Intronic
933940649 2:87242101-87242123 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
934714620 2:96536627-96536649 GCGCGGAGAAGGCGGGGGGCGGG - Intergenic
934782215 2:96977947-96977969 GGGCGGGGGAGGGGGGCGACCGG + Intronic
934880451 2:97972457-97972479 AGGGAGGGAAGGCGGGCGGGAGG + Intronic
934956931 2:98631027-98631049 GGTCAGGCATGGCGGGCGGAGGG - Intronic
935592485 2:104855380-104855402 GGGCGGGGAAGGAGGGGGGGAGG + Intergenic
935717623 2:105952954-105952976 GGGTGAGGAAGGCAGGAGGAAGG - Intergenic
935746450 2:106193915-106193937 GGGCGCGGACCCCGGGCGGAGGG - Intronic
936662738 2:114560220-114560242 GGGAGGAGAAGGAGGGCAGAGGG + Intronic
936972031 2:118185558-118185580 CGGCGGGGGAGGGGGGAGGAGGG + Intergenic
937066112 2:119019249-119019271 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
937070197 2:119057403-119057425 GGGCAGGGAAGGCTGGGGGTAGG - Intergenic
937221488 2:120345274-120345296 GGGCGAGGAAGGCGAGGGGGAGG - Intergenic
937221511 2:120345315-120345337 GGGCCGCGCAGGCAGGCGGAGGG + Intergenic
937914707 2:127093106-127093128 GGTCAGGGAGGGAGGGCGGAAGG + Intronic
937966799 2:127518274-127518296 GGGAGGCCAAGGCGGGCGGATGG + Intronic
938301508 2:130217527-130217549 GAGCGGGGGACGGGGGCGGAGGG - Intergenic
938472316 2:131576051-131576073 GGGCGGGGATGGGGGGCGGGAGG - Intergenic
938592102 2:132749441-132749463 GGGAGGCCAAGGCGGGTGGATGG - Intronic
939799964 2:146696844-146696866 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
939799970 2:146696855-146696877 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
939799976 2:146696866-146696888 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
939799982 2:146696877-146696899 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
939799988 2:146696888-146696910 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
939799994 2:146696899-146696921 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
939799998 2:146696910-146696932 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
939900410 2:147844277-147844299 GGGCGAGGAGGCGGGGCGGACGG - Intergenic
940353843 2:152717937-152717959 AGGCGGGGAAGGCGAAAGGAGGG + Exonic
940420597 2:153476871-153476893 GGGTGGGGCCGGGGGGCGGAGGG - Intergenic
940665548 2:156604521-156604543 GGGAGGCCAAGGCGGGCAGATGG - Intronic
940742323 2:157522978-157523000 GGGAGGCCAAGGCGGGCGGGCGG + Intergenic
940775221 2:157876768-157876790 GCGCGGGGCAGGCGGGCGGACGG + Intronic
940883343 2:158968606-158968628 GGCCGAGCAAGGCGGGGGGACGG + Intergenic
941095824 2:161238806-161238828 GAGCGCGGCAGGCAGGCGGAGGG - Intergenic
941188233 2:162344078-162344100 GGGCGGGGCTGGCCTGCGGAAGG + Exonic
941412620 2:165178467-165178489 GGGAGGCCGAGGCGGGCGGATGG - Intronic
941603144 2:167563974-167563996 GGACGGGGCAGCCGGCCGGACGG + Intergenic
941933253 2:170963483-170963505 GGGCGGGGGAGGGGGGCGGGAGG - Intronic
941951314 2:171160205-171160227 GGGCGGGGGGGGCGGGGGGGGGG + Intronic
942129993 2:172868971-172868993 GGGAGGCCAAGGCGGGAGGATGG - Intronic
942276728 2:174328544-174328566 GGGCAGGGAAGGCGGGCGGGCGG + Intergenic
942314227 2:174683014-174683036 TGGCGGGGCAGGCGGGCGCGCGG - Intergenic
942807296 2:179946468-179946490 GGGGGGGGAAGGGGAGGGGAGGG + Intronic
943042428 2:182819753-182819775 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
943692412 2:190881634-190881656 GGGCGGGGAAGGCGCGGGCGGGG - Intronic
944060055 2:195563124-195563146 GGGCGGGGGAAGTGGGGGGAGGG - Intergenic
944598414 2:201282792-201282814 GGACGGGGCAGCCGGCCGGAAGG + Intronic
944765744 2:202862595-202862617 GGGAGGGCGAGGCGGGTGGATGG + Intronic
945588337 2:211695980-211696002 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
946329599 2:219001897-219001919 GGCCAGGAAAGCCGGGCGGAGGG - Intergenic
946391313 2:219418429-219418451 GGGCGAGGCTGGCGGGCGCACGG - Exonic
946409658 2:219509715-219509737 GGGCTTGGAAGGAGGGCAGATGG - Intergenic
946428839 2:219613940-219613962 GGGAGGGGAAGGCAGGAGGGTGG + Intronic
946519080 2:220446611-220446633 GGGCAGGGAGGGAGGGGGGAAGG - Intergenic
946712524 2:222520997-222521019 GGGAGGCCAAGGCGGGAGGACGG - Intronic
946926083 2:224628281-224628303 GGGAGGCGAAGGTGGGAGGATGG - Intergenic
946966472 2:225042413-225042435 GCGCGGGGAAGACCGGCGGGAGG - Exonic
947106791 2:226675984-226676006 GGGAGGCCAAGGCGGGCGGATGG + Intergenic
947381145 2:229546494-229546516 GGGAGGCCAAGGCGGGGGGATGG + Intronic
947408684 2:229810118-229810140 GGGAGGCCAAGGCGGGAGGAAGG + Intronic
947523379 2:230864880-230864902 GGGCGGGGAGGGCTGGGGGTGGG + Exonic
947641043 2:231708074-231708096 GGGAGGGGAAGGCGGGGTGCTGG - Intronic
947779351 2:232743553-232743575 GGGGGTGGAAGGCAGGAGGAGGG - Intronic
947885447 2:233566159-233566181 GAGGGGGGAAGGGGAGCGGAGGG + Intronic
948229955 2:236342288-236342310 GGCCGGGGCAGGTGGGAGGAAGG + Intronic
948256935 2:236575251-236575273 GGGCTGGGAAGGTAGGAGGAGGG - Intronic
948393254 2:237627397-237627419 GGGCGGGGGACGGGGGCGGGGGG - Intergenic
948402123 2:237692047-237692069 GGGCGGGGAAGGCGGGTCATGGG + Intronic
948495919 2:238349828-238349850 GGGAGGCCGAGGCGGGCGGATGG + Intronic
948623149 2:239249311-239249333 GGGCGGGGAGGGGCTGCGGAAGG + Intronic
948751523 2:240136115-240136137 GGGAGGGGAGGCCGGGCGGGTGG - Intronic
948801378 2:240435136-240435158 AGGCGCGGCCGGCGGGCGGAGGG + Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
948945728 2:241218030-241218052 GGGCGGGGCGGGGGGGCGGCGGG + Intronic
948953934 2:241272713-241272735 GGCCTGGGCGGGCGGGCGGACGG - Intronic
949017921 2:241723903-241723925 GGGAGGCGGAGGCGGGAGGATGG + Intronic
1168753398 20:299106-299128 GGGCGGGGAGGGCGGGAGGGGGG - Exonic
1168965617 20:1896211-1896233 GCTCGGGGAAGGCAGGAGGAAGG - Intronic
1168982029 20:2013023-2013045 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1169118742 20:3083189-3083211 GGGCGGGGTGAGCGGGAGGAGGG + Intronic
1169164023 20:3407420-3407442 GGGCGGGGGATGCGGGCTGTCGG - Intronic
1169189184 20:3646521-3646543 TGGAGGGGAAGGCGGAGGGAGGG + Intronic
1169216254 20:3796404-3796426 GGGGGGGGAAGGAGGGAGGGAGG - Exonic
1169263380 20:4153434-4153456 GGGCCAGGAAGGAGGGAGGAGGG + Intronic
1169438083 20:5611043-5611065 GGGCGGGGCCGGAGGGCGGTGGG + Intergenic
1169456674 20:5758330-5758352 GGGAGGGGAAGGGAGGGGGAGGG + Intronic
1169673726 20:8132190-8132212 TGGCGGGGAAGGGGGGCGGGGGG + Intronic
1170587999 20:17750118-17750140 GGCCGGGGAAGAGGGTCGGATGG - Intergenic
1170627266 20:18039380-18039402 GGGAGGCCAAGGCGGGTGGATGG + Intronic
1170687160 20:18579832-18579854 GGGAGGGCAAGGGGGGTGGATGG + Intronic
1171182106 20:23098415-23098437 AGGCTGGGAAGGTGGGAGGAAGG - Intergenic
1171185505 20:23121532-23121554 GGGCGGGGCATGCGGGGGGCAGG - Intergenic
1171447480 20:25215017-25215039 GGGCGGGGAGGGGTGGCGGATGG - Intronic
1172101183 20:32484478-32484500 GGGGCGGGGAGGAGGGCGGAGGG - Intronic
1172118018 20:32583436-32583458 GGCCGGGGGAGGAGCGCGGAGGG + Intronic
1172118640 20:32585225-32585247 GGCCGGGGGAGGCGGGAGGCGGG + Intronic
1172180608 20:33001187-33001209 GAGCAGGGAAGGCAGGGGGAGGG - Intronic
1172322873 20:34010474-34010496 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1172343182 20:34175505-34175527 GGGTGTGGAAGGCAGGAGGAGGG + Intergenic
1172423934 20:34842276-34842298 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1172656691 20:36542152-36542174 GGGTGGGGAAGGTCTGCGGAGGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172986918 20:38999036-38999058 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1173216538 20:41090216-41090238 GGGAGGCCAAAGCGGGCGGAGGG - Intronic
1173279794 20:41618155-41618177 GAGCGGGGCCGGCGGGCGGGCGG - Intronic
1173564828 20:44031167-44031189 GGTGGGGGAAGGTGGGCGAATGG + Intronic
1173821159 20:46021647-46021669 GCGGGGGGCGGGCGGGCGGAGGG + Intergenic
1173822652 20:46029271-46029293 GAGCGGCGAAGGCGGGTAGAGGG + Intronic
1173852719 20:46228887-46228909 AGGCGGGAGAGGCGGGCGGCGGG - Intronic
1173931661 20:46825872-46825894 GGGGGGGGAAGATGGGAGGAGGG + Intergenic
1174231238 20:49046869-49046891 GGGCGGGGACTGCGGGCGCGTGG + Intronic
1174350947 20:49967606-49967628 GGGAGGGAAAGGGGGGCGGGGGG - Intergenic
1174415855 20:50366508-50366530 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1174418168 20:50381148-50381170 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1174494601 20:50930879-50930901 CGGCGGCGGCGGCGGGCGGATGG + Exonic
1174804494 20:53593866-53593888 GGGCGGGGAGGGCGGAGGGAGGG + Intronic
1175210457 20:57350886-57350908 GGGCGGGGGGGGCGGGGGGACGG + Intergenic
1175210494 20:57350939-57350961 GGGCGGGGGGGGCGGGGGGCGGG + Intergenic
1175224897 20:57439268-57439290 GGGCAGGGCAGGGGGGCTGAAGG - Intergenic
1175833035 20:61977503-61977525 GAACGGGGAAGGGGGGAGGAAGG - Intronic
1175834489 20:61984918-61984940 GGGCGAGCAAGGTGGGAGGAGGG + Intronic
1175903045 20:62367424-62367446 GGGGGGGGAAGGAGAGAGGAGGG + Intergenic
1175944028 20:62550508-62550530 GGGCGGGGGAGGGGAGGGGAGGG - Exonic
1175964132 20:62652015-62652037 GGGTGGGGGAGGCGGGGGCAGGG - Intronic
1176056172 20:63150452-63150474 GGGCGGGGAAGGGTGGGGAAGGG + Intergenic
1176138358 20:63534783-63534805 GAGCGGGCCAGGTGGGCGGAGGG + Intronic
1176139492 20:63538725-63538747 GGGTGGGGAATGCGGAAGGAGGG + Intergenic
1176156946 20:63626823-63626845 GGGAGGGGAGGGCCGGGGGAGGG - Intronic
1176179443 20:63742524-63742546 GGGCGGGGCAGGCGGCCGCAGGG - Exonic
1176190825 20:63808733-63808755 GGGAGGCCGAGGCGGGCGGATGG + Intronic
1176207166 20:63895366-63895388 GGCCCGGGCAGGCGGGCGGGCGG + Intronic
1176223621 20:63981652-63981674 AGGCGGGGCGGGCGGGCGGGCGG - Intronic
1176234606 20:64048568-64048590 GGGCGCGTAGGGCGCGCGGAAGG + Exonic
1176237973 20:64063109-64063131 GGGCGCGGCAGGCGGGCGCGTGG + Intronic
1176270451 20:64233312-64233334 GGGAGGGGAAGGGGAGGGGAGGG - Intronic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1176366118 21:6033928-6033950 CTCCGGGGCAGGCGGGCGGATGG + Intergenic
1176375888 21:6086707-6086729 GGGCGAGGAAGCCGGGCCCAGGG + Intergenic
1176381784 21:6117444-6117466 GGGCGGGGACGGCAGGCGCAAGG - Intronic
1176549254 21:8214424-8214446 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1176557147 21:8258647-8258669 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1176568186 21:8397462-8397484 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1176576089 21:8441682-8441704 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1176705198 21:10111407-10111429 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1176733489 21:10521912-10521934 GGACGGGGAGGGCGGAGGGAGGG - Intronic
1177157355 21:17512992-17513014 GGGCTGGGAGGAGGGGCGGAGGG + Exonic
1178322313 21:31614806-31614828 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1178322319 21:31614817-31614839 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1178322325 21:31614828-31614850 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1178628216 21:34236363-34236385 GGGTGGGGAAGGTGGAGGGAGGG - Intergenic
1179102730 21:38368758-38368780 GAGCGGGGAGGGTGGGAGGAGGG - Intergenic
1179411769 21:41168115-41168137 CGGCGGGGAGGACGGGAGGAGGG - Exonic
1179626772 21:42653549-42653571 GGGAGGGGCGGGCGGGCGGCCGG + Intergenic
1179674949 21:42974833-42974855 GGGCGGGGAGGGGGCGCGGGTGG + Intronic
1179721308 21:43317545-43317567 GGGAGGCCAAAGCGGGCGGATGG - Intergenic
1179741688 21:43420795-43420817 GGGCGGGGACGGCAGGCGCAAGG + Intronic
1179757399 21:43504617-43504639 CTCCGGGGCAGGCGGGCGGATGG - Intergenic
1179786460 21:43733255-43733277 GGGCGGGGGGGGCGGGGGGGGGG - Intronic
1179801994 21:43815394-43815416 GGGCGGGGCAGGGGGGCGGCGGG + Intergenic
1180038682 21:45264666-45264688 GGGCGGGGCAGTCGGGGTGAGGG + Exonic
1180038693 21:45264691-45264713 GGGCGGGGCAGTCGGGGCGAGGG + Exonic
1180085387 21:45505784-45505806 TGGCGGGGAGGGCGGGGGGCAGG - Intronic
1180086823 21:45511266-45511288 AGCCAGGGAAGGCGGGCGGGCGG + Intronic
1180161556 21:46000625-46000647 GGCCGGGGAAGGGGGGAGGCCGG + Intronic
1180161564 21:46000642-46000664 GGCCGGGGAAGGAGGGCGGCCGG + Intronic
1180177499 21:46097838-46097860 GGGCGGGGGCGACGGGCGGCCGG + Intergenic
1180491656 22:15854167-15854189 GGGCGTGGAAGGCGGGGGCCAGG + Intergenic
1180559144 22:16601742-16601764 GCGCGGGGAGGGCGGGCCGCGGG - Intergenic
1180560397 22:16610268-16610290 GGGCGGGGAGGGAGGGAGGGAGG + Intergenic
1180649722 22:17368663-17368685 GTGCTTGGAAGGCGGGGGGATGG - Intronic
1180876246 22:19176549-19176571 GGGCCGGGAAGGGGAGGGGAAGG - Intronic
1180876848 22:19178664-19178686 GCGCGGGCATGGCGGGCGGGAGG + Exonic
1180951450 22:19722356-19722378 GGGCGGCGGAGGCGGGCGTCAGG + Intronic
1181125985 22:20702749-20702771 GGTGGGGCAGGGCGGGCGGAAGG + Intergenic
1181160062 22:20954712-20954734 GGGCGGGGAGGGCGGTGAGAAGG - Intergenic
1181239322 22:21468057-21468079 GGTGGGGCAGGGCGGGCGGAAGG + Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181457970 22:23070378-23070400 GGCGCGGGAGGGCGGGCGGAGGG + Exonic
1181522590 22:23458223-23458245 GGCCGGGGAAGGCGGGTGCCTGG + Intergenic
1181568485 22:23753546-23753568 GGGCGGGGAAGTGGGGGAGAGGG - Intronic
1181596255 22:23916814-23916836 GGGGAGGGAAGGCGAGGGGAGGG + Intergenic
1182037296 22:27209138-27209160 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1182125190 22:27810904-27810926 GCTCAGGGAAGGGGGGCGGAGGG - Intergenic
1182232502 22:28849459-28849481 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1182243178 22:28933784-28933806 GGGAGGGGGAGGAGGGAGGAGGG - Intronic
1182260962 22:29073001-29073023 GGGCGGGGCGGCCGGGCGGCCGG + Intergenic
1182373168 22:29826548-29826570 GGGAGGCCAAGGCAGGCGGATGG - Intronic
1182510318 22:30815040-30815062 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1182586246 22:31345853-31345875 GGGAAGGGGAGGCGGGCGGGCGG - Exonic
1182587882 22:31355986-31356008 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1182624894 22:31638423-31638445 GGGCGAGGAAGGGGGGATGAAGG + Intronic
1182695766 22:32198479-32198501 GGGCTGGGGAGGGGGGCGTAGGG + Intronic
1182721508 22:32404924-32404946 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1182825704 22:33262875-33262897 GGGGAGGGGAGGCGAGCGGAGGG - Intronic
1183427060 22:37745899-37745921 GGGCGGAGGATGCGGGCGGCCGG - Intronic
1183483047 22:38075337-38075359 GGGAGGGGAGGGAGGGTGGAGGG - Exonic
1183483192 22:38075977-38075999 GGGCGGGGGAAGGGGGCGGGGGG - Intergenic
1183535519 22:38398548-38398570 GGGCGGGGAGGGCGGAGGGAGGG + Intergenic
1183740246 22:39664995-39665017 GGGCGGGGAGGGCGGAGTGAGGG - Intronic
1183846363 22:40544464-40544486 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1183924719 22:41197572-41197594 TGGCCGGGAAGGCGGGCGCGCGG - Intergenic
1184043435 22:41957931-41957953 GGGCGGGGCGGGCTGGGGGAGGG - Intergenic
1184053092 22:42023432-42023454 GGGAGGGCAAGGCGGGCAGATGG - Intronic
1184101538 22:42343858-42343880 AGCCGGGGAGAGCGGGCGGAGGG + Intergenic
1184229952 22:43153017-43153039 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1184276453 22:43411875-43411897 AGGCGGGGAGGGCGGGCGTGGGG + Intronic
1184430367 22:44438694-44438716 GGGCGGGGCCGGAGGGCGGCAGG - Intergenic
1184461500 22:44640423-44640445 GGGCCGGGGAGGAGGGAGGAGGG + Intergenic
1184485291 22:44774833-44774855 GGGTGGGGGCGGGGGGCGGATGG + Intronic
1184557454 22:45240959-45240981 GGGCGGGGAAGGGGCGGGGCCGG - Intergenic
1184620253 22:45671681-45671703 GGGAGGGGACGCCGGGGGGAGGG - Intergenic
1184663784 22:45977219-45977241 GAGCGAGGAGGGCGGGCGGGAGG - Intergenic
1184683409 22:46085134-46085156 GGACCGGGAAGGCGGGCCGAGGG + Intronic
1184785446 22:46669377-46669399 CGGCGGGGAAGGAGGGTGGCTGG + Intronic
1184796812 22:46737842-46737864 GGTCGGGGCAGGCGGGAGGGAGG - Intronic
1184890606 22:47376776-47376798 AGGCTGGGAAGGAGGTCGGAAGG - Intergenic
1185151734 22:49167644-49167666 GGGCGGGGAGGGGGTGTGGAGGG + Intergenic
1185229826 22:49673591-49673613 GGGGGGGGAAGGGAGGAGGAGGG + Intergenic
1185317628 22:50185871-50185893 GGGCGGGGCGGACGGGCCGAGGG - Intergenic
1185409408 22:50674357-50674379 GGGCGGGGGCGGCGGGGGGAGGG - Intergenic
1185414582 22:50702958-50702980 GGGCTGGGAAGGCTGGTGGGTGG + Intergenic
1203254139 22_KI270733v1_random:130740-130762 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1203262195 22_KI270733v1_random:175819-175841 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
949865283 3:8542239-8542261 GGGAGGCCAAGGCGGGCAGATGG - Intronic
951017044 3:17742684-17742706 GCGCGGGGAGGGCGCGCGGCGGG - Intronic
952335291 3:32398742-32398764 GGGAGGCCGAGGCGGGCGGATGG + Intronic
952493105 3:33890885-33890907 GGGAGGTCAAGGCGGGAGGATGG - Intergenic
952902187 3:38117712-38117734 GGGCTGGGAGGGCTGGGGGAGGG - Intronic
952970788 3:38649276-38649298 GGGAAGGGAAGGGGGGCGCACGG + Intronic
953029860 3:39172097-39172119 GGGCAGGGATGGAGGGAGGAGGG + Intergenic
953156241 3:40377100-40377122 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
953171141 3:40508855-40508877 GGGAGGTGGAGGCGGGAGGATGG - Intronic
953171387 3:40510981-40511003 GGGAGGCCAAGGCAGGCGGATGG - Intronic
953748701 3:45594051-45594073 GGGCGGGGACGGCGCGCGGGCGG - Intronic
954390277 3:50264927-50264949 GGGTGGGGCAGGCGGGGGTAGGG + Intergenic
954540692 3:51391482-51391504 GGGAGGCGGAGGCGGGCGGGCGG + Exonic
954782823 3:53073384-53073406 GGGCGGGGAAACGGGGAGGAGGG + Intronic
954861632 3:53695436-53695458 GGGCGGGGCAGGAGGAGGGATGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
956159672 3:66335899-66335921 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
956882166 3:73521377-73521399 GGGAGGGGTAGGCGGGCAGATGG + Intronic
957086046 3:75678138-75678160 AGGGGGGGAAGGTGGGAGGAGGG - Intergenic
957194054 3:77045049-77045071 GGGGGAGGGAGGCGGGCGGTAGG + Intronic
958034682 3:88155694-88155716 GGGAGGAGGAGGCAGGCGGATGG - Intronic
958732581 3:97974509-97974531 GGGCGGGGAGGGAGGGAGGAAGG + Intergenic
958906579 3:99948529-99948551 GGGAGGGGAAGGGAGGGGGAGGG + Intronic
958942924 3:100334887-100334909 CGGCGGGGACGCGGGGCGGAGGG - Intronic
959085719 3:101849335-101849357 GGGCGAGGGCGGAGGGCGGAGGG + Intronic
959185253 3:103038647-103038669 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
959596820 3:108137416-108137438 GGCGGGGGGAGGGGGGCGGACGG + Intergenic
959732396 3:109619092-109619114 GGGAGGGGAAGGCAGGGGAAGGG - Intergenic
960272900 3:115693795-115693817 GGGCGGGGCAGGGGAGAGGATGG + Intronic
960638975 3:119809558-119809580 CGGGGGGGAAGGCGGGGGGGTGG + Intronic
961071774 3:123936690-123936712 GGGAGGGGAAGGTGGTAGGAGGG + Intronic
961247957 3:125473179-125473201 GAGCGGGGAGGGAGGGTGGAAGG - Intronic
961459108 3:127039080-127039102 GGGCAGGGAAGGCCTGAGGAGGG + Intergenic
961545263 3:127629009-127629031 TGGCGGGGGGGACGGGCGGAGGG + Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961612583 3:128152922-128152944 CGGGGGGGAGGGCGGGGGGACGG - Intronic
961612600 3:128152948-128152970 GGGCGGGGGGGGCGGGAAGACGG - Intronic
961612626 3:128152996-128153018 GGGGGGCGAAGGGGGGCGGGGGG - Intronic
962072204 3:132044676-132044698 GGGAGGGGAGGGAGGGGGGAGGG + Intronic
962134929 3:132722717-132722739 GGGCGGGGAGGGAGAGCGGAAGG + Intergenic
962222428 3:133574376-133574398 GGCCGCGGAGGCCGGGCGGACGG + Intronic
962340050 3:134575150-134575172 GGGAGGGGAAGGGGGACGGAGGG - Intergenic
962960923 3:140310274-140310296 GGGCGGGGAGGGGGTGCGGTGGG - Intronic
963240728 3:143000169-143000191 GGGCGGGGCAGGGGGGGGGGTGG - Intronic
963289931 3:143477350-143477372 GGGAGGGGGCGGCGGGGGGAGGG - Intronic
963503873 3:146161104-146161126 CGGCGGGCAAGGCGCGCGGCCGG + Exonic
964451504 3:156817037-156817059 GGGCGGGGCCGGCGGGCTGCAGG + Intergenic
964570564 3:158105026-158105048 GGGCGGGGGGGGGGGGCGGCGGG - Intronic
964629601 3:158795752-158795774 GGGAGGCCAAGGAGGGCGGATGG - Intronic
964720406 3:159763931-159763953 GGGCGGGGAAGGGGCGGGGCGGG + Intronic
965770278 3:172174920-172174942 GGGGGGGGGTGGCGGGGGGAAGG - Intronic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966246052 3:177809021-177809043 GGGCGGGGGCGGGGGGAGGAGGG + Intergenic
966411825 3:179653073-179653095 GGGCGGGGAGAGCGGGCTGCGGG - Exonic
966594585 3:181713602-181713624 GGGTGGGGAGGGCGGGGGAATGG + Exonic
966860910 3:184230477-184230499 GGCCGGGGAAGCTGGGCGCAGGG - Exonic
966866664 3:184261907-184261929 GGGGCGGGAAGGCGGCCGCAGGG + Intronic
967055476 3:185825532-185825554 GGGCGGGGAAGGCGCGCCCCGGG + Intergenic
967337537 3:188361435-188361457 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
967734032 3:192933458-192933480 GGGCGGCCAAGGCCGGCAGATGG - Intergenic
967904196 3:194487076-194487098 AGGCGGGGAAGGGGCGGGGAGGG + Intronic
968084894 3:195869854-195869876 GGCCGTGGAAGGAGGGAGGAGGG + Intronic
968267016 3:197370160-197370182 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
968434184 4:576395-576417 GGGCGGGGAAGGGCGGCGCCAGG - Intergenic
968455435 4:696094-696116 GGGAGGCCGAGGCGGGCGGATGG + Intergenic
968532374 4:1099502-1099524 GGGCGGGGAAGGCCAGGAGAAGG + Intronic
968584137 4:1408106-1408128 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
968653113 4:1767717-1767739 GCGCGGGCGTGGCGGGCGGAAGG - Intergenic
968659559 4:1793477-1793499 GGGCCGGGCAGGCTCGCGGAGGG + Intronic
968663120 4:1806973-1806995 GGCCGGGGACGGCAGGGGGAGGG - Intronic
968701279 4:2059340-2059362 GGGCGGAGGCGGCGGGCGGCCGG - Intergenic
968736496 4:2299639-2299661 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
968820117 4:2843868-2843890 GGGCGGTGGGGGCGAGCGGAGGG + Exonic
968985380 4:3871878-3871900 GGGAGGGGAAGGACGGCGGCGGG + Intergenic
969051359 4:4375496-4375518 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
969379389 4:6783610-6783632 GGGCGGGGGAGGAGGGCCGCAGG + Intronic
969559839 4:7939886-7939908 GGGGCGGGACGGCGGGCGGCGGG - Exonic
969718346 4:8879234-8879256 GGGCGGGGGAGGGGGGTGAATGG - Intergenic
970754878 4:19413862-19413884 GGGGGGGGGGGGCGGGCGGGGGG - Intergenic
971014308 4:22471311-22471333 GAGCGGGGAAGATGGGAGGAGGG + Intronic
971196220 4:24473122-24473144 GGTCGGAGAAGGCGGCCGGCCGG - Intergenic
971563103 4:28106268-28106290 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
971759090 4:30741431-30741453 GGGAGGCCAAGGCGGGCAGATGG - Intronic
971760538 4:30759179-30759201 GGGAGGCCAGGGCGGGCGGATGG - Intronic
972396918 4:38664984-38665006 CGGCGGGGGGCGCGGGCGGAGGG - Intronic
972401653 4:38709914-38709936 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
972454716 4:39242359-39242381 GGGAGGCTAAGGCGGGAGGATGG - Intronic
972543382 4:40057598-40057620 GGGCAGGGGAGGCGGGACGAGGG - Intronic
972786974 4:42335532-42335554 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
973613685 4:52659320-52659342 GGGCGGGGAGGGAGCGCGGAGGG + Exonic
974021319 4:56693920-56693942 GGGAGGCCAAGGCGGGCGGCTGG + Intergenic
974036386 4:56821738-56821760 GCGCGGGGAGGGCGGGGGAAGGG + Exonic
974542261 4:63252093-63252115 GGGAGGGAAAGGCAGGTGGATGG - Intergenic
974833370 4:67216388-67216410 GGGAGGGGAAGGGAGGGGGAGGG + Intergenic
974925918 4:68297136-68297158 GAGGGTGGAAGGCGGGAGGAGGG - Intergenic
975801067 4:78059112-78059134 GGGCGGCGGCGGCGGGCGCAGGG + Intronic
976470570 4:85423982-85424004 GTGTGTGGAAGGGGGGCGGAGGG + Intergenic
976614010 4:87057895-87057917 GGGTGGGGATGGTGGGCGGGGGG - Intronic
976616788 4:87086409-87086431 GGGAAGGGAAGGAGGACGGATGG - Intronic
977188089 4:93965896-93965918 GGGTGGGGAAGACAGGGGGAAGG - Intergenic
977210066 4:94208121-94208143 GGGCGGGGGAGGCGGACGAAGGG + Intronic
977694456 4:99950472-99950494 GGCGGGGGAAGGCGGAGGGATGG + Intergenic
977776919 4:100931632-100931654 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
978351486 4:107824898-107824920 GGGCGGGGAGAGCGGGCGCGGGG + Intronic
978702329 4:111662629-111662651 GGGAGGGGGAGGAGGGAGGATGG + Intergenic
978783744 4:112585163-112585185 GGGAGGCCAAGGCGGGAGGATGG + Intronic
978789535 4:112646207-112646229 GGGAGGCCAAGGCGGGTGGATGG - Intronic
979195647 4:117917152-117917174 GGGTGGGGAAGGTGGGTTGAGGG - Intergenic
979349447 4:119628043-119628065 GGGCGGGGAAGCTGGGGTGAGGG - Intronic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980053777 4:128061472-128061494 GGACGGGGCCGGCGGGCGGTTGG + Intronic
981413335 4:144458747-144458769 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
981528666 4:145732639-145732661 GGGCGGGGCGGGTGGGGGGAGGG - Exonic
981782909 4:148445655-148445677 GGGCCCGGCAGGCGGGCGGCCGG + Intergenic
981814006 4:148807660-148807682 GGAAGGGGAAGGAGGGTGGAAGG + Intergenic
982329860 4:154169550-154169572 GGGCGGGGAAGGGTGGGGGAGGG - Intergenic
982329866 4:154169560-154169582 GGGCGGGGAAGGGCGGGGAAGGG - Intergenic
982573063 4:157075014-157075036 GGGAGGCTAAGGCAGGCGGATGG + Intergenic
983247001 4:165298933-165298955 GGGGGGGGAGGGGGGGCGGGGGG - Intronic
983317604 4:166151834-166151856 GGGAGGCCAAGGCGGGCGGGCGG + Intergenic
983353042 4:166618692-166618714 AGGCGGGGGAGGGGGGCGGGGGG + Intergenic
983868524 4:172797482-172797504 GGGAGGCTGAGGCGGGCGGATGG - Intronic
983904421 4:173169170-173169192 GGGCGGGGAAGAGCGGAGGAAGG - Intronic
983939635 4:173525998-173526020 AGGCGGGAAAGGGGGGTGGAGGG - Intronic
984394844 4:179183825-179183847 GGGAGTGCGAGGCGGGCGGATGG + Intergenic
984923417 4:184785603-184785625 GGGCGGGGGGGGGGGGGGGAAGG + Intronic
984973500 4:185210186-185210208 CGGCGGCGAAGTCGGGCGGCTGG - Intronic
984999659 4:185471213-185471235 GGGCGGGGAGGGCGGGGCGGAGG + Intronic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985324145 4:188748704-188748726 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
985443972 4:190009397-190009419 GAGCGGGGAAGGTGGGAGAAGGG + Intergenic
985611524 5:892272-892294 GGGAGGGAAAGGCGGGAGAAAGG + Intronic
985616566 5:926586-926608 GGGCGGGGAAGAAGCGCGGACGG - Intergenic
985708376 5:1414456-1414478 GGGCGGGGAAGGCGCTGGGTGGG + Intronic
985708393 5:1414494-1414516 GGGCGGGGAAGGCGCTGGGTGGG + Intronic
985782125 5:1876826-1876848 GGGCGGGAAGGGCGTGTGGAAGG - Intergenic
985995652 5:3595732-3595754 GGCCGGCGAGGGCGGGCGGGAGG + Intergenic
986530102 5:8726995-8727017 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
986856663 5:11876262-11876284 GGGCAGGAAAGGCGGGGAGAGGG + Intronic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987231077 5:15894046-15894068 GGGAGGCCAAGGCGGGCGGTCGG + Intronic
987373933 5:17217509-17217531 GGGCGGGGAGCGCGGGAGGAGGG + Intronic
987414857 5:17652040-17652062 GGGAGGGGAAGGGAGGAGGATGG - Intergenic
988824672 5:34923515-34923537 GGGAGGCCAAGGCGGGCAGATGG - Intronic
989011425 5:36876820-36876842 GGGGGGGGAGGGCGGGGGGAAGG - Exonic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
990376590 5:55176631-55176653 GGGCGGGGAAGGCGTGCCCCAGG - Intergenic
990446182 5:55896574-55896596 GGAGGGGGAAGGTGGGGGGAAGG - Intronic
990456709 5:55995339-55995361 GGGCGGGGGCAGCGGGCGGCGGG - Intergenic
990756219 5:59073504-59073526 GGGCGGGGGGGGCGGGTGGTTGG + Intronic
991063314 5:62400988-62401010 GGGAGGCTAAGGCGGGTGGATGG - Intronic
991587314 5:68214935-68214957 GGGCGGGGTTGGCGGGGGGTGGG - Intergenic
991631445 5:68660512-68660534 GGGCAAGGAAGTCGGGTGGATGG + Intergenic
991769217 5:70025320-70025342 GGGAGGCGCAGCCGGGCGGAGGG + Exonic
991848512 5:70900738-70900760 GGGAGGCGCAGCCGGGCGGAGGG + Exonic
992627585 5:78648939-78648961 GGACGGGGGCGGCGGGCGGGCGG + Intronic
992635741 5:78724487-78724509 GGGCGGGGGGGGGGGGGGGATGG + Intronic
994050758 5:95359499-95359521 GGGCAGGGAAGGGGAGGGGAGGG + Intergenic
994100115 5:95882593-95882615 GGGTGGGGGTGGGGGGCGGATGG + Intergenic
996003921 5:118398348-118398370 GGTCGGGGGAGGGGGGAGGAGGG - Intergenic
996367332 5:122716775-122716797 GGGCAGGGAAGGGGAGGGGAGGG + Intergenic
996404994 5:123095473-123095495 GGGCTGGGGAGCCGGGCAGAGGG - Intronic
996715834 5:126587396-126587418 GGGAGGCCAAGGCGGGTGGATGG + Intronic
997454759 5:134008147-134008169 GGGCGGGGATCGGGGGCGGTGGG - Intergenic
997538384 5:134640616-134640638 GGGAGGCCAAGGCGGGTGGATGG + Intronic
997906506 5:137822541-137822563 AGGCGGGGGCGGGGGGCGGAGGG + Intergenic
998018839 5:138753367-138753389 GGGCGGGGGCCGCGGGCGGGGGG + Intronic
998119146 5:139561729-139561751 GGGCGGGGAAGGGACGGGGAAGG - Exonic
998406741 5:141878494-141878516 GGGCCGGGAGGGAGGGGGGAGGG - Intronic
998807309 5:145931269-145931291 GGGAGGCTAAGGCAGGCGGATGG - Intergenic
999334157 5:150700783-150700805 GGCCGGAGCAGGAGGGCGGAGGG - Intronic
999451322 5:151680473-151680495 GGGAGGCTGAGGCGGGCGGATGG - Intronic
999999756 5:157126460-157126482 GGGAGGGGAAGGGGAGGGGAAGG + Intronic
1001070859 5:168583737-168583759 GGGAGGTGAAGGTGGGAGGATGG - Intergenic
1001438955 5:171723517-171723539 GGGGCGGGAGGGGGGGCGGACGG + Intergenic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002400496 5:178989186-178989208 GGAGGGGGAAGGCGGGAGGCCGG - Intronic
1002490032 5:179569234-179569256 GGGTGGGGAAGGAGTGGGGATGG + Intronic
1002666889 5:180831609-180831631 GGGCGGGGACGCCGGGAGGCGGG + Intergenic
1002841839 6:913120-913142 GGGCGGGGGAGGGGGGCGCGGGG - Intergenic
1002888864 6:1317166-1317188 GGGAGGGGTAGGCGGGAGGAGGG - Intergenic
1002896821 6:1384310-1384332 AGCCTGGGAAGGCGGGCGGGAGG + Intergenic
1002917724 6:1542206-1542228 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
1003058189 6:2841668-2841690 TGGCGGGGAGGGCGAGCGCAGGG + Intronic
1003094765 6:3133533-3133555 GGGAGGGGAAAGTGGGGGGAGGG - Intronic
1003551862 6:7107801-7107823 GGGCGAGGAAGCTGGGCGGGGGG + Exonic
1004044253 6:12011275-12011297 GGGAGGGGGAGGCGGGGGGGGGG - Intronic
1004163493 6:13235194-13235216 GGGCGGGGTAGGTGGGGTGAGGG - Intronic
1004216941 6:13711783-13711805 GGGAGGGGAAGGCGCGCTGGCGG + Intergenic
1004335585 6:14761660-14761682 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1004561818 6:16760069-16760091 GGGCAGGGAAGGGGGCCGGACGG - Intronic
1004924363 6:20403406-20403428 GGGCGGGGAAGGAAGGGGCAAGG - Intronic
1005004252 6:21272007-21272029 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
1005883042 6:30074805-30074827 GGGAGGGAGCGGCGGGCGGAAGG - Intronic
1006014783 6:31071510-31071532 AGGCCGAGGAGGCGGGCGGAGGG + Intergenic
1006122229 6:31814636-31814658 AGGCGGGGAAGGCGGGGTAAGGG - Intronic
1006180724 6:32151961-32151983 GGGCGGGGGGGGCGGGCGGAGGG + Intronic
1006317212 6:33297989-33298011 GGGCGGGGCGGGGGGGCGGGGGG + Intronic
1006333700 6:33410148-33410170 GGGCTGGGGTGGCCGGCGGAAGG - Intergenic
1006366907 6:33621362-33621384 GGGCGGGGCGGGCGGGCGGCGGG + Exonic
1006544936 6:34772765-34772787 GGGAGGGGAGGGCAGGCAGAGGG - Intronic
1006642571 6:35496689-35496711 GGGTGGGGAGGGCGGGGGGCGGG + Intronic
1007433730 6:41792955-41792977 GGTCGGGGATGGCGGGTGGTGGG - Exonic
1007479737 6:42142249-42142271 GGGCGGGGACGGAGGGCGCTGGG - Intronic
1007566511 6:42855299-42855321 GGGAGGCCAAGGCAGGCGGATGG + Intronic
1007785360 6:44276552-44276574 GCGAGGGGCAGGCGGGAGGACGG - Exonic
1008286206 6:49654104-49654126 GGGAAGGGAAGGGGAGCGGAGGG - Intergenic
1008666787 6:53724627-53724649 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1009441776 6:63688313-63688335 GGGAGGGGAAGGGAGGGGGAAGG - Intronic
1009704965 6:67238655-67238677 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1010703227 6:79077552-79077574 GGGCGGGGGAGGGGAGCGGGCGG - Intronic
1010788041 6:80028555-80028577 GGGGGGCTGAGGCGGGCGGATGG - Intronic
1010921199 6:81682926-81682948 GGGAGGGGAAGGGAGGGGGAAGG + Intronic
1011410238 6:87059749-87059771 GGGAGGGGGAGGCGGGGGGAGGG + Intergenic
1011590012 6:88963161-88963183 GGGAGGGGATGGTCGGCGGATGG - Intronic
1012111600 6:95242093-95242115 GGGAGGGGAAGGGAGGGGGAGGG + Intergenic
1012237562 6:96836989-96837011 GGGCAGGGGAGGGGGGCGGGCGG + Intronic
1012245782 6:96924471-96924493 GGGCGGGGGCGGGGGGCGGCAGG + Intergenic
1012276694 6:97283010-97283032 GGGCGGAGAAGGCGGGGTGCCGG + Exonic
1013099463 6:106974831-106974853 GGGCGGGGAAGGCGGGGAGGCGG - Intronic
1013212007 6:107995436-107995458 GGGAGGCCAAGGTGGGCGGATGG + Intergenic
1013215317 6:108022134-108022156 GGGAGGCGAAGGTGGGAGGATGG - Intergenic
1013248870 6:108314636-108314658 GGGAGGCCGAGGCGGGCGGATGG - Intronic
1013341686 6:109221530-109221552 GGGAGGGGAAGGGAGGAGGAGGG - Intergenic
1013341693 6:109221546-109221568 GGGAGGGGAAGGGAGGGGGAGGG - Intergenic
1013341706 6:109221568-109221590 GGGAGGGGAAGGGGAGAGGAAGG - Intergenic
1013576017 6:111483730-111483752 GGGAGGGAAGGGCGGGCGGGCGG + Intergenic
1013858522 6:114605096-114605118 GGGAGGTGAAGGTGGGAGGATGG + Intergenic
1014160032 6:118157245-118157267 GTGCAGGGAAGGCAGGAGGAGGG + Intronic
1014205551 6:118651685-118651707 GGGCGGGGACTGCGGGGGGCGGG + Intronic
1014205559 6:118651701-118651723 GGGCGGGGACTGCGGGGGGCGGG + Intronic
1015069346 6:129071886-129071908 GGGAGGCCAAGGCAGGCGGATGG + Intronic
1015093327 6:129385141-129385163 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1015566275 6:134574651-134574673 GGGCGGGGAGGGCGGACAGTGGG + Intergenic
1015755710 6:136604080-136604102 GGGAGGCCAAGGCAGGCGGAGGG + Intronic
1015818338 6:137233525-137233547 GGGAGGGCAAGGCAGGCGGATGG - Intergenic
1015821954 6:137270917-137270939 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1015869320 6:137760127-137760149 GGGAGGTGAAGGCAGGAGGATGG - Intergenic
1016772823 6:147870821-147870843 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1016803430 6:148189451-148189473 GGGAGGCCAAGGCGGGTGGATGG - Intergenic
1016839994 6:148516497-148516519 GGGCGGGGGAGGGGGGAGGGGGG - Intronic
1017459158 6:154632941-154632963 GGGAGGCCAAGGCAGGCGGATGG - Intergenic
1017587703 6:155945532-155945554 GGGAGGGGATGGCAGGAGGAAGG - Intergenic
1017696696 6:157022177-157022199 GGGCGGGGCCGGCGGGAGGTGGG + Intronic
1017842291 6:158232040-158232062 GGCCGGGGAGGGAGGGCGGCCGG + Intergenic
1018757478 6:166862691-166862713 GGGCTGGGGAGGCGGGGGGGGGG + Intronic
1018813797 6:167316516-167316538 GGGCAGGGAAGGCGGTTGGCGGG - Intergenic
1018837214 6:167494116-167494138 GGGCGGGGAAGGCGGGAGAAGGG + Intergenic
1018906625 6:168079555-168079577 GGACGAGGAGGGCGGGAGGAAGG + Intronic
1019112815 6:169730653-169730675 GGGAGGCCGAGGCGGGCGGATGG + Intergenic
1019179290 6:170176693-170176715 GGGCCGGGAAGGAGGGCGCGGGG + Intergenic
1019197527 6:170291105-170291127 GGGCGGGGAAGGGTGGGGGCGGG - Intergenic
1019197582 6:170291261-170291283 GGCCCGGGAGGGCGTGCGGAGGG - Intergenic
1019324108 7:429618-429640 AGCCGGTGAAGGCGGGAGGAGGG - Intergenic
1019335707 7:481593-481615 GGGCGGGAAGGGAGGGAGGAGGG - Intergenic
1019366763 7:637044-637066 GGGAGGCTAAGGCGGGTGGACGG + Intronic
1019413687 7:917705-917727 GGGAGGCCTAGGCGGGCGGATGG - Intronic
1019478688 7:1256161-1256183 GCGTGGGGAAGGCGGGAGGCTGG - Intergenic
1019498640 7:1353122-1353144 GGGTGGGGAAGGCGGTGGGCAGG - Intergenic
1019517568 7:1446564-1446586 GGGAGGGGGAGGGGGGAGGAGGG + Intronic
1019537911 7:1538483-1538505 GGGCGGGGCGGGAGGGCGGCTGG + Intronic
1019563972 7:1670671-1670693 GGACGGCGAAGGGGGACGGAAGG - Intergenic
1019588734 7:1818321-1818343 GGCCGGGGAAGGCGGGTGCCTGG - Intronic
1019719558 7:2559767-2559789 GGGGGGGGGGGGGGGGCGGAGGG + Intronic
1019731493 7:2631898-2631920 GGGCGGGGCCGGCGGGCGGACGG + Intergenic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1020034989 7:4959226-4959248 GGGCGGGGCGGGCGGGGGCACGG + Intergenic
1020204725 7:6105383-6105405 GGGCCGGGCAGGCAGGCGGGAGG + Intronic
1020235042 7:6348782-6348804 GCGCGGAGAGGGCGGGCGGGGGG - Exonic
1020461411 7:8433730-8433752 GGGCGGGGAAGGGCGCGGGAGGG - Intergenic
1021623314 7:22568951-22568973 GGGAGGTCAAGGCGGGTGGATGG - Intronic
1021868149 7:24979400-24979422 GGGTTGGGAAGGCGGGCGAGCGG + Intronic
1021892654 7:25201497-25201519 GGGAGGCGAAGGCTGGTGGATGG - Intergenic
1021979970 7:26044726-26044748 GGGTGGGGAATGCGGGGAGATGG - Intergenic
1022311481 7:29200461-29200483 GGGGGGGGAAGGGGGGAGGGGGG - Intronic
1022714976 7:32891353-32891375 GGGCGGGGGAGGGGCGCGGGCGG - Intronic
1022722979 7:32957416-32957438 CGGCCGGGAGGGCGGGCGGCCGG + Exonic
1022952346 7:35350981-35351003 GGGCGGGGAAGGTGGGGTGTGGG + Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023167916 7:37361717-37361739 GGGAGGCCAAGGCCGGCGGATGG + Intronic
1023638599 7:42237145-42237167 GCGCGGGGAAGGCGGGAGAGCGG + Intronic
1023781928 7:43663869-43663891 GGGCGGCCAAGGCAGGCAGATGG + Intronic
1023874020 7:44277156-44277178 GGGCTGGGCAAGCGGGCGGGGGG + Intronic
1023881950 7:44325697-44325719 GCGCGGGGAAGGCGCGTGCAGGG - Intronic
1025032863 7:55571947-55571969 CGGCGGGGAGAGGGGGCGGACGG + Intronic
1025916786 7:65872966-65872988 GGGCGGGGCAGGGGTGGGGAGGG - Intergenic
1025987273 7:66464554-66464576 GGGAGGCGAAGGTGGGAGGATGG + Intergenic
1026003544 7:66582120-66582142 GGGAGGCGAAGGTGGGAGGATGG + Intergenic
1026027727 7:66760866-66760888 GGGAGGCGAAGGTGGGAGGATGG - Intronic
1026360555 7:69598442-69598464 GCGCGAGGCAGGCGGGCGGGCGG + Intergenic
1026630260 7:72031984-72032006 GGGAGGTGGAGGAGGGCGGACGG - Intronic
1026762566 7:73137768-73137790 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026762608 7:73137878-73137900 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026806150 7:73430498-73430520 GGGAGGGGGAGGGGGGAGGAGGG - Intergenic
1026846166 7:73700244-73700266 GGGCGGGGACGGAGGGCCCATGG + Exonic
1026948246 7:74330016-74330038 GGGAGGCCAAGGCAGGCGGATGG - Intronic
1027039029 7:74947544-74947566 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039071 7:74947654-74947676 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039081 7:74947676-74947698 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027057823 7:75062276-75062298 GGGCAGCCAAGGCGGGAGGATGG + Intronic
1027084552 7:75254679-75254701 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084558 7:75254690-75254712 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084570 7:75254712-75254734 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084580 7:75254734-75254756 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084606 7:75254800-75254822 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084648 7:75254910-75254932 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084658 7:75254932-75254954 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027210549 7:76143420-76143442 GGGAGGCGAAGGTGGGAGGATGG + Intergenic
1027352698 7:77327817-77327839 GAGCGGGGATGGCTGGAGGAGGG - Intronic
1027476097 7:78633241-78633263 GAGGGCGGAAGGCGGGAGGAGGG + Intronic
1028328628 7:89559719-89559741 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1028398970 7:90404033-90404055 GGGGGGAGGAGGGGGGCGGAGGG + Intronic
1028534961 7:91881716-91881738 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1029110366 7:98210841-98210863 GGTCGGGGAAAGCGGGCGGGGGG + Intergenic
1029169210 7:98618588-98618610 GGGCGGGGGGGGGGGACGGAGGG - Intronic
1029283582 7:99451793-99451815 GGGCGAGGCAGCCGGGAGGAAGG - Intronic
1029392143 7:100282517-100282539 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1029392163 7:100282561-100282583 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
1029525611 7:101092151-101092173 GGGAGGCCAAGGCGGGCGGCTGG - Intergenic
1029715088 7:102321389-102321411 GGGCGAGGCAGGCGGGCAGGCGG - Exonic
1030055845 7:105583168-105583190 GGGCGGGGGCGGCGGGGGGACGG + Intronic
1030120075 7:106101432-106101454 GGGGGGGGGGGGGGGGCGGATGG - Intronic
1030602646 7:111609673-111609695 GGGCGGCCAAGGCAGGCGGCCGG - Intergenic
1031866064 7:127039844-127039866 GGACGGGGAAGGGAGGGGGAAGG + Intronic
1032058258 7:128701349-128701371 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1032091844 7:128915225-128915247 GGAGGGGGGAGGGGGGCGGAGGG - Intergenic
1032110054 7:129068332-129068354 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032368995 7:131327783-131327805 GGGCGGGGAGCGCGGGCGGCCGG + Intronic
1032393740 7:131574310-131574332 GGGAGGCCAAGGCGGGAGGATGG - Intergenic
1032707167 7:134431496-134431518 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1033092848 7:138402865-138402887 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1033132537 7:138757274-138757296 GGGAGGCTAAGGCGGGTGGATGG + Intronic
1033192610 7:139295678-139295700 GGGAGGCCAAGGCAGGCGGATGG + Intronic
1033207983 7:139438917-139438939 GGGCGGGGTGGGGGGGGGGAGGG - Intergenic
1033329415 7:140405547-140405569 GGGCGGGGAGGGGGGGCGCAGGG + Intronic
1033477189 7:141702184-141702206 GGGCGGGGCGGGCGGGCTGCGGG + Intergenic
1033632781 7:143176906-143176928 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1033825650 7:145186867-145186889 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
1033939630 7:146636185-146636207 GGGCAGGGCAGGGGGGCGGGGGG + Intronic
1034174480 7:149090340-149090362 GGGCGAGGATGCCGGGCGGACGG - Intronic
1034219973 7:149436543-149436565 GGGCGGGGACGGCCGGGGAAGGG - Intronic
1034264077 7:149772981-149773003 GGGCGCGGACGGCGGGCGTGGGG - Intronic
1034411072 7:150942453-150942475 GGGCAGTGCAGGCGGGAGGATGG + Intergenic
1034433333 7:151051576-151051598 GGGCGGGGGAGGGGAGGGGAGGG + Intronic
1034455498 7:151167811-151167833 GCGCGGCGGCGGCGGGCGGAGGG - Intronic
1034618096 7:152436080-152436102 GGGCGGGGCAGCCGGGCGGGCGG + Intergenic
1035303540 7:157915440-157915462 TGGCGGGGAAGGCGGGGGTGGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035776385 8:2191475-2191497 GGGGGGGGAAGGGAGGGGGAAGG - Intergenic
1035776454 8:2191611-2191633 GGGGGGGGAAGGGAGGGGGAAGG - Intergenic
1035776505 8:2191706-2191728 GGGGGGGGAAGGGAGGGGGAAGG - Intergenic
1036172029 8:6496519-6496541 GGCGGGGGAAGGGGGGCGGGGGG - Intronic
1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG + Intergenic
1036453974 8:8892602-8892624 GGGCGGGCAGGGCGGGCAGCTGG + Exonic
1036561510 8:9903618-9903640 GGGTGGGGAACGCCGGAGGAAGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036950329 8:13133537-13133559 GGGCGGGGCGGGGGGGAGGAGGG - Intronic
1037194827 8:16176265-16176287 GGGAGGCCAAGGCGGGAGGATGG + Intronic
1037480613 8:19302036-19302058 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1037980658 8:23250960-23250982 GTGCGGGGAAGGGGTGCAGATGG - Intronic
1038001591 8:23396376-23396398 GGGAAGGGAAGGAGGGAGGAAGG + Intronic
1038176267 8:25184459-25184481 GGGTGGGGAGGGCGGGAGAAAGG + Intergenic
1038304134 8:26383556-26383578 GGGCGGGGAGGCCGGGTGGGCGG + Intronic
1038490552 8:27967506-27967528 GGGTGGGGGCGGCGGGGGGACGG + Intronic
1038548666 8:28446284-28446306 GTGCGGGGGAGGCAGGAGGATGG - Intronic
1038575628 8:28701558-28701580 CGGCCTGGAAGGCGGGCGGCCGG + Exonic
1039282554 8:36002285-36002307 GGGAGGTGAAGGTGGGAGGATGG + Intergenic
1039478539 8:37854863-37854885 GGGAGGGGAAGGGTGGCTGACGG + Intergenic
1039564661 8:38542486-38542508 GGGAGGGGAAGGGGGAGGGAAGG - Intergenic
1039839992 8:41286352-41286374 CGGCGGGGGAGGCGGTGGGAAGG - Intronic
1039964084 8:42271409-42271431 GGGCGGGGAAGGCGGGGCTGGGG - Exonic
1040038880 8:42896880-42896902 GGGCGGGGACGCGGGGCGGCGGG + Intronic
1040292386 8:46132149-46132171 GGGTGGGGTGGGCGGGCGGCAGG - Intergenic
1040312112 8:46242116-46242138 GGGTGGGGTGGGCGGGCGGCAGG + Intergenic
1040471352 8:47738013-47738035 GGGCGGGCAAGCCGGGCCGCGGG - Exonic
1040495414 8:47961079-47961101 GGGCAGGGAAGCCGGGAGGCGGG + Exonic
1040846477 8:51847385-51847407 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042082615 8:65071548-65071570 GGGCGCGGGGGGCGGGGGGAGGG + Intergenic
1042177890 8:66055697-66055719 GGGAGGTCAAGGCGGGTGGATGG + Intronic
1042249053 8:66737853-66737875 GGGAGGCCAAGGTGGGCGGATGG - Intronic
1042591769 8:70403658-70403680 GGGCCGCGAGGGCGGGCGGGGGG - Intronic
1042858910 8:73294506-73294528 GGGCGGGGAGGCCGGGCGGAGGG + Intronic
1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG + Exonic
1043472104 8:80573338-80573360 GGGCGGGGACGGCTGGCGCAAGG - Intergenic
1043908299 8:85833016-85833038 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
1043969502 8:86514403-86514425 GGGCGGGGAGGGGGCGGGGATGG - Intronic
1043970178 8:86519949-86519971 GGGAGGCTGAGGCGGGCGGATGG - Intronic
1045367869 8:101493420-101493442 AGGCGGGGGAGGGGGGAGGAAGG - Intronic
1045447587 8:102283329-102283351 GGAAGGGGAAGGCGGGGGGGGGG + Intronic
1045488823 8:102654767-102654789 GGGGCGGGAAGGTGGGCGGGGGG - Intronic
1045510825 8:102810762-102810784 GGGCGGGGAGGGCGCGGGGAGGG + Intergenic
1046015618 8:108601160-108601182 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1047024389 8:120811117-120811139 GGGGGGGGAAGGGTGGCGCAGGG - Intronic
1047026898 8:120834115-120834137 GGGTGGGGAAGGCGGCCAGGAGG + Intergenic
1047124778 8:121948343-121948365 GGGCGGGGGCGGGGGGCGGTGGG - Intergenic
1047827043 8:128588113-128588135 GGGGGTGGAAGGAGGGTGGATGG - Intergenic
1049090774 8:140511895-140511917 GGGCGGGAGAGGCGCGCGGTAGG - Intronic
1049109816 8:140635692-140635714 GGGCGGGGGAGGAAGGAGGAGGG + Intergenic
1049112922 8:140660482-140660504 GGGCGGCGGAGGCAGGCTGACGG + Intronic
1049129603 8:140826674-140826696 GGGAGGCGGAGGCGGGTGGATGG + Intronic
1049194631 8:141308493-141308515 GGGCGGGGCAGGGGCGCGGCGGG - Intergenic
1049222365 8:141433919-141433941 GGGAGGGGAAGGCGGTGGGTGGG + Intergenic
1049237333 8:141518786-141518808 CGGCGGGGAAGGGGGGCGGTGGG + Intergenic
1049240651 8:141535945-141535967 GGGTGGGGGCGGCGGGCGGTGGG + Intergenic
1049358860 8:142202351-142202373 GGGCGGAGACGGCGGCTGGAGGG - Intergenic
1049409239 8:142465042-142465064 AGACAGGGGAGGCGGGCGGATGG + Intronic
1049439361 8:142602173-142602195 GGGTGGGGAAGCCCTGCGGATGG - Intergenic
1049541700 8:143211700-143211722 GCGTGGGGGAGGCGGGCCGAGGG + Intergenic
1049580516 8:143408606-143408628 GGGGTGGGAAGGCTGACGGAGGG - Intergenic
1049599144 8:143498953-143498975 GGGCGGGGAAGAGGGGCACAGGG + Intronic
1049718170 8:144103535-144103557 GGGCGGTGAGTGGGGGCGGAGGG - Exonic
1049724119 8:144137680-144137702 GGGCGGGACCGGCGTGCGGAGGG - Intergenic
1049756551 8:144313628-144313650 GGGCGGGGAGGCGGGGCGGCGGG - Intronic
1049762297 8:144336950-144336972 GCGCAGGGAGGGCGGGCCGAGGG + Intergenic
1049838518 8:144755339-144755361 AGGCGGGGAGGGCGCGGGGAGGG - Intronic
1049868025 8:144951379-144951401 GGGAGGCCGAGGCGGGCGGATGG + Intergenic
1049975957 9:861667-861689 AGACGGGGAAGCCGGGCAGAGGG + Intronic
1049989234 9:976574-976596 GGGCGGGGGTGGCGGTGGGAAGG + Intergenic
1050974975 9:11926471-11926493 GAGCAGGGAAGGTGGGAGGAGGG + Intergenic
1051170316 9:14314325-14314347 GGGCGAGGCGGGCGGGCGGGCGG - Intronic
1051269026 9:15336894-15336916 GGGAGGCTAAGGCCGGCGGATGG + Intergenic
1051785275 9:20735480-20735502 GGGAGGGGAGGGGAGGCGGAAGG - Intronic
1052780154 9:32773878-32773900 GGGAGGCCAAGGTGGGCGGATGG - Intergenic
1052821107 9:33138457-33138479 GGGCAGGGAAGGTGGGAGCAAGG - Intronic
1053073000 9:35111895-35111917 GGGCGGGGGAGTAGGGCGGAGGG - Intronic
1053130157 9:35610044-35610066 GGGTGGGGGAGGAGGGCGCACGG - Exonic
1053329306 9:37188803-37188825 GGGAGGGGAAGGGGAGGGGAGGG - Intronic
1053642465 9:40098496-40098518 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1053642471 9:40098507-40098529 GGGAGGGGAAGGGGAGGGGAAGG + Intergenic
1053642478 9:40098518-40098540 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1053763674 9:41366980-41367002 GGGAGGGGAAGGGGAGGGGAGGG - Intergenic
1054323335 9:63695786-63695808 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1054456609 9:65434530-65434552 GGGTGGAGGAGGCTGGCGGAGGG - Intergenic
1054542289 9:66278137-66278159 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1054731430 9:68705614-68705636 GGGAGGGGCGGGAGGGCGGAGGG - Intronic
1054776061 9:69124449-69124471 GGGAGGCCAAGGCGGGAGGATGG - Intronic
1055028932 9:71752481-71752503 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1056530474 9:87482516-87482538 GGGAGGGGAAGGGGGAAGGAGGG + Intergenic
1057361938 9:94381273-94381295 GGGAGGCCGAGGCGGGCGGATGG - Intronic
1057385354 9:94601679-94601701 GGGAGGCCAAGGCGGGCGGGCGG - Intergenic
1057480341 9:95440479-95440501 GGGAGGGGAAGGAGGGAGAAGGG + Intergenic
1057489669 9:95511207-95511229 GGGCGGGGAGAGCCGGCGGACGG - Intronic
1057661419 9:97006891-97006913 GGGAGGCCGAGGCGGGCGGATGG + Intronic
1057773038 9:97984055-97984077 GGCCGGGGAAGGGGCGCGGGTGG + Intronic
1057942425 9:99296634-99296656 GTGCGGGGAGGCCGGGCGGGAGG + Intergenic
1058023712 9:100117599-100117621 GGGCGGGGGGGGCGGGGGGCCGG - Intronic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058467539 9:105244548-105244570 GGGCGCGGGAGGCGGGAGGCGGG + Intergenic
1058885881 9:109320801-109320823 GGGCGCGGGAGGCGGGCTGCGGG + Exonic
1059145669 9:111897102-111897124 GGGCGCGGGAGGCGAGAGGAAGG - Exonic
1059191769 9:112333658-112333680 GGGTGGGGAAGGCGGGGGCGCGG - Intronic
1059208318 9:112486949-112486971 GAGCGGGGAAGGCGCCCGGCGGG - Exonic
1059368232 9:113804059-113804081 GGGAGGGCAAGGCAGGAGGATGG + Intergenic
1059405964 9:114098508-114098530 GGGCGGGGCACGCGGGAGGAGGG + Intronic
1059414316 9:114154033-114154055 GGGCGGGGAGGGGGCGCTGAAGG - Intergenic
1059965482 9:119609668-119609690 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1060301129 9:122375201-122375223 TGGCGGGGGAGGCGGGAGGGGGG + Intronic
1060504209 9:124186116-124186138 GGGCGGGGGAGGTGGGCTGGGGG - Intergenic
1060799540 9:126535010-126535032 GGGCGGGGCAGCCGGGCAGCTGG - Intergenic
1060907011 9:127315534-127315556 GGGAGGGTAAGGCAGGAGGATGG + Intronic
1060974303 9:127755368-127755390 GGGAGCGGGGGGCGGGCGGAGGG - Intronic
1061005766 9:127927823-127927845 GGTCGGGGAAGGGGGCCGGGTGG - Intronic
1061075771 9:128340636-128340658 GGGCGGGGTAGGAGCGCGGCGGG + Intronic
1061196500 9:129109900-129109922 GGGTGGGGAAGGGGGCTGGAGGG + Intronic
1061196514 9:129109936-129109958 GGGTGGGGAAGGGGGCTGGAGGG + Intronic
1061390532 9:130315181-130315203 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1061390558 9:130315230-130315252 GGGAGGGGAAGGGGAGGGGAGGG - Intronic
1061390565 9:130315241-130315263 GGGAGGGGAAGGGGAGGGGAAGG - Intronic
1061390571 9:130315252-130315274 GGGAGGGGAAGGGGAGGGGAAGG - Intronic
1061801938 9:133117524-133117546 GGGCGGGGGAGGCAGTGGGATGG - Intronic
1061885687 9:133590106-133590128 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1061885693 9:133590117-133590139 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1061885699 9:133590128-133590150 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1061885705 9:133590139-133590161 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1061885711 9:133590150-133590172 GGGAGGGGAAGGGGAGGGGAAGG - Intergenic
1061885755 9:133590327-133590349 GGGCCTGGAAGGCGGACGGGAGG + Intergenic
1061895174 9:133643359-133643381 GGGAGGGGAGGGTGGGCGGCCGG + Intronic
1061931254 9:133834255-133834277 GGCCGAGTAAGGCGGGGGGATGG - Exonic
1061947129 9:133914696-133914718 GGGAGGGGAAGGAGAGGGGAGGG + Intronic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1062306056 9:135907620-135907642 GGGCGGGGCAGGCGCGAGAAGGG - Intergenic
1062335117 9:136061521-136061543 GGTAGGGGAAGGCGGATGGATGG + Intronic
1062421141 9:136483286-136483308 AGGCGTGGAAGACGGGCGGGGGG - Intronic
1062421192 9:136483448-136483470 GGGCGGGGAAGGACGGCCGAGGG - Intronic
1062449716 9:136610345-136610367 GGGCGGGGGAGGGGGGTGGGGGG + Intergenic
1062450642 9:136614370-136614392 GGGTGGGGAAGGCGGGAGCCGGG - Intergenic
1062483616 9:136763584-136763606 GGGCGGGGAGGGCGGGCAGGGGG + Intronic
1062484987 9:136770198-136770220 GTGCGGGGCAGGCGGGGTGAGGG - Intergenic
1062485001 9:136770230-136770252 GTGCGGGGCAGGCGGGGTGAGGG - Intergenic
1062485015 9:136770262-136770284 GTGCGGGGCAGGCGGGGTGAGGG - Intergenic
1062504648 9:136866625-136866647 GGCCGGGCCACGCGGGCGGAGGG + Intronic
1062567011 9:137167964-137167986 CAGCGGGGTGGGCGGGCGGACGG - Exonic
1062583874 9:137240448-137240470 GGGCAGGGGAGGGGAGCGGAGGG - Intergenic
1062584131 9:137241455-137241477 GGGCGGTGTGGGCGGGCGGCCGG + Intronic
1062584191 9:137241600-137241622 GGGCGGGGGAGGGGCGGGGAGGG + Intronic
1062655931 9:137604794-137604816 GTGCGGGGAAGGCAGGGGGCGGG + Intergenic
1202790230 9_KI270719v1_random:81504-81526 GGGAGGGGAAGGGGAGGGGAGGG + Intergenic
1203470540 Un_GL000220v1:113884-113906 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1203478361 Un_GL000220v1:157856-157878 GGGAAGGGAGGGCGGGTGGAGGG - Intergenic
1185447549 X:267371-267393 GGGAGGCCAAGGCGGGCGGATGG - Intergenic
1185457584 X:318606-318628 GGGCGGGGCCTGCGGGCGGACGG - Exonic
1185615739 X:1420660-1420682 GGGCGGGGAAAGGGGAAGGAGGG + Intronic
1185756638 X:2659142-2659164 GGGAGGGGAAGGGGGAAGGAAGG - Intergenic
1185829737 X:3289245-3289267 GAGCGGGGAGGGTGGGAGGAAGG - Intergenic
1186100583 X:6152053-6152075 GGGAGGGTGAGGCGGGAGGATGG - Intronic
1186312887 X:8339522-8339544 GGGAGGCCAAGGCGGGAGGATGG + Intergenic
1186539911 X:10389727-10389749 GGGGGGGGGTGGCGGGCGGGGGG + Intergenic
1186788540 X:12975202-12975224 GGGCGGGGACGGAGGCAGGACGG - Exonic
1186852661 X:13595957-13595979 GGGAGGGCAAGGCGGGAGGATGG - Intronic
1186901991 X:14066386-14066408 GGGGGGGGGGGGCGGGCGGCGGG - Intergenic
1187163817 X:16786808-16786830 CGGCGGGGAAGCCGGGAGGGAGG + Intronic
1187181347 X:16946558-16946580 GGGCGGGGCAAGCGGGAGGCGGG + Intergenic
1187865411 X:23719028-23719050 GGGAGGCGAGGGCGGGTGGATGG + Intronic
1188277295 X:28216025-28216047 GGGGGGGGAAGGAGGGAGGGGGG - Intergenic
1188303465 X:28533043-28533065 GGGAGGGGAAGAAGGGTGGAAGG + Intergenic
1188425832 X:30045667-30045689 GGGAGGCAAAGGCGGGTGGATGG - Intergenic
1189262538 X:39688915-39688937 GGGCGGGGGAGGGGAGAGGAAGG - Intergenic
1189281223 X:39821248-39821270 GGGCGGGGAGGGCGGGGCGGTGG + Intergenic
1189324992 X:40106545-40106567 GCGCGGGGAGGGCGGGAGGCGGG - Intronic
1189377100 X:40474652-40474674 GGGCGGGGGGGGCGGGCAGAGGG + Intergenic
1189573933 X:42329737-42329759 GAGCGTGGAAGGTGGGAGGAGGG + Intergenic
1190201797 X:48368126-48368148 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1190208742 X:48427285-48427307 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1190596151 X:52053952-52053974 GGGCGGGGAGGGTGAGGGGAGGG - Intronic
1190612673 X:52200121-52200143 GGGCGGGGAGGGTGAGGGGAGGG + Intronic
1192127686 X:68517384-68517406 GGGAGGCCGAGGCGGGCGGATGG - Intronic
1192428125 X:71095358-71095380 GGGGGATGAAGGCGGGTGGAGGG + Intergenic
1192546483 X:72018706-72018728 GGGCGGGGGAGGAGGGCGGGCGG - Intergenic
1193085946 X:77447965-77447987 GGGAACGGGAGGCGGGCGGACGG + Intronic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1194948604 X:100097875-100097897 GGGGGTGGAAGGTGGGAGGAGGG + Intergenic
1195210798 X:102651383-102651405 GTGTCGGGAAGGGGGGCGGAGGG - Exonic
1195216947 X:102712348-102712370 GTGTCGGGAAGGGGGGCGGAGGG - Exonic
1195221089 X:102745960-102745982 GTGTCGGGAAGGGGGGCGGAGGG - Intronic
1195728039 X:107937184-107937206 GGCGGGGGACGGAGGGCGGAGGG - Intergenic
1196031182 X:111096760-111096782 GGGCTGGGTAGGGGGGCGGGCGG - Intronic
1196402437 X:115330495-115330517 GGGAGGGGGAGGTGGGCGGGGGG + Intergenic
1196431078 X:115626521-115626543 GGGAGGCCAAGGTGGGCGGATGG - Intronic
1197573239 X:128176147-128176169 GGGGGTGGAAGGTGGGAGGAGGG + Intergenic
1197607126 X:128597558-128597580 TGGCGGGGAAGGCAAGGGGAAGG - Intergenic
1197695013 X:129540635-129540657 GGGCGGGGGAGGGCGGCGGTGGG + Intronic
1197774478 X:130110564-130110586 GGGCGGGGAAGAAGGGCGGGCGG - Intronic
1197785729 X:130194838-130194860 GGGAGGGCAAGGCAGGGGGATGG + Intergenic
1197892176 X:131278780-131278802 GGGAGGGGAAGGGAGGCGGGAGG - Intronic
1198264307 X:134995186-134995208 GGGAGGCCAAGGTGGGCGGATGG - Intergenic
1198369125 X:135974080-135974102 GGGCGGGGTAGGCAGACGGGCGG + Intergenic
1198371918 X:135997653-135997675 GGGAGGCGGAGGTGGGCGGATGG - Intronic
1198683205 X:139203584-139203606 GGGCGGGGAGAGGGGGCTGAAGG + Intronic
1198809895 X:140524586-140524608 GGGAGGGGAAGGGGAGGGGATGG + Intergenic
1199832985 X:151562869-151562891 GGGCGGGGGGGGCGGGGGGGCGG + Intergenic
1199846308 X:151695016-151695038 GGGCGGGCAAGCCGGGCCGGAGG - Intergenic
1200063681 X:153494928-153494950 AGGCTGGGCAGGCGGGCCGACGG - Exonic
1200101067 X:153689263-153689285 GGGAGGGGAGGGCAGGGGGAGGG - Intronic
1200180032 X:154144442-154144464 GGGCGGGGCAGGTGGGTGGCCGG - Intronic
1200185860 X:154182836-154182858 GGGCGGGGCAGGTGGGTGGCCGG - Intergenic
1200191512 X:154219974-154219996 GGGCGGGGCAGGTGGGTGGCCGG - Intronic
1200197267 X:154257778-154257800 GGGCGGGGCAGGTGGGTGGCCGG - Intronic
1200229462 X:154436933-154436955 GGGCGGGGCGGGCCGGCGGCCGG - Exonic
1200239608 X:154486741-154486763 GGGCGGGGCCGGGGCGCGGACGG - Intergenic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1200418226 Y:2935347-2935369 CGGCTGGTAGGGCGGGCGGAGGG - Intronic
1200684366 Y:6246092-6246114 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1200687009 Y:6266416-6266438 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1200989887 Y:9337333-9337355 GGGCAGGGAAGGCGGGGGTTGGG + Intergenic
1200992556 Y:9357666-9357688 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1200995208 Y:9377944-9377966 GGGCAGGGAAGGCGGGGGGGTGG + Intronic
1200997873 Y:9398290-9398312 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1201000381 Y:9466823-9466845 GGGCAGGGAAGGCAGGGGGGTGG + Intergenic
1201003044 Y:9487136-9487158 GGGCAGGGAAGGCGGGGGGTGGG + Intronic
1201005703 Y:9507419-9507441 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1201008363 Y:9527749-9527771 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1201048268 Y:9908294-9908316 GGGCAGGGAAGGCGGGGGGTGGG - Intergenic
1201148738 Y:11082896-11082918 GGGAGGTCAAGGCGGGTGGATGG - Intergenic
1201328984 Y:12798065-12798087 GGGAGGGGAAGGGGGAGGGAAGG - Intronic
1201699496 Y:16864756-16864778 GGGTGGGGGAGGGGGGAGGAGGG + Intergenic