ID: 1107146673

View in Genome Browser
Species Human (GRCh38)
Location 13:37067783-37067805
Sequence AGGTTTTAAGAGCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107146673_1107146678 15 Left 1107146673 13:37067783-37067805 CCCTACTCCAGCTCTTAAAACCT No data
Right 1107146678 13:37067821-37067843 TGTACATCAGTAGAGTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107146673 Original CRISPR AGGTTTTAAGAGCTGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr