ID: 1107149003

View in Genome Browser
Species Human (GRCh38)
Location 13:37090732-37090754
Sequence CCCATAGGGTATCCAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107149003_1107149014 25 Left 1107149003 13:37090732-37090754 CCAGACTTTGGATACCCTATGGG No data
Right 1107149014 13:37090780-37090802 CTGTTCTTCTTGATGTACTGTGG No data
1107149003_1107149009 -8 Left 1107149003 13:37090732-37090754 CCAGACTTTGGATACCCTATGGG No data
Right 1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107149003 Original CRISPR CCCATAGGGTATCCAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr