ID: 1107149009

View in Genome Browser
Species Human (GRCh38)
Location 13:37090747-37090769
Sequence CCTATGGGTGGTGATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107149001_1107149009 -5 Left 1107149001 13:37090729-37090751 CCACCAGACTTTGGATACCCTAT No data
Right 1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data
1107148998_1107149009 4 Left 1107148998 13:37090720-37090742 CCTCCATTGCCACCAGACTTTGG No data
Right 1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data
1107149003_1107149009 -8 Left 1107149003 13:37090732-37090754 CCAGACTTTGGATACCCTATGGG No data
Right 1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data
1107149000_1107149009 1 Left 1107149000 13:37090723-37090745 CCATTGCCACCAGACTTTGGATA No data
Right 1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data
1107148997_1107149009 20 Left 1107148997 13:37090704-37090726 CCTGTCTCTTCTCATTCCTCCAT No data
Right 1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107149009 Original CRISPR CCTATGGGTGGTGATGAGGC TGG Intergenic
No off target data available for this crispr