ID: 1107149014

View in Genome Browser
Species Human (GRCh38)
Location 13:37090780-37090802
Sequence CTGTTCTTCTTGATGTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107149008_1107149014 10 Left 1107149008 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG No data
Right 1107149014 13:37090780-37090802 CTGTTCTTCTTGATGTACTGTGG No data
1107149003_1107149014 25 Left 1107149003 13:37090732-37090754 CCAGACTTTGGATACCCTATGGG No data
Right 1107149014 13:37090780-37090802 CTGTTCTTCTTGATGTACTGTGG No data
1107149007_1107149014 11 Left 1107149007 13:37090746-37090768 CCCTATGGGTGGTGATGAGGCTG No data
Right 1107149014 13:37090780-37090802 CTGTTCTTCTTGATGTACTGTGG No data
1107149001_1107149014 28 Left 1107149001 13:37090729-37090751 CCACCAGACTTTGGATACCCTAT No data
Right 1107149014 13:37090780-37090802 CTGTTCTTCTTGATGTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107149014 Original CRISPR CTGTTCTTCTTGATGTACTG TGG Intergenic
No off target data available for this crispr