ID: 1107156430

View in Genome Browser
Species Human (GRCh38)
Location 13:37172407-37172429
Sequence CAGCAAACAGCAGTGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107156423_1107156430 19 Left 1107156423 13:37172365-37172387 CCGGATCCGGAGGGATGGAAGTC No data
Right 1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG No data
1107156422_1107156430 23 Left 1107156422 13:37172361-37172383 CCTGCCGGATCCGGAGGGATGGA No data
Right 1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG No data
1107156420_1107156430 24 Left 1107156420 13:37172360-37172382 CCCTGCCGGATCCGGAGGGATGG No data
Right 1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG No data
1107156424_1107156430 13 Left 1107156424 13:37172371-37172393 CCGGAGGGATGGAAGTCAGCAGC 0: 14
1: 58
2: 95
3: 108
4: 250
Right 1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107156430 Original CRISPR CAGCAAACAGCAGTGGCGGA GGG Intergenic
No off target data available for this crispr