ID: 1107156608

View in Genome Browser
Species Human (GRCh38)
Location 13:37174514-37174536
Sequence AGAATGAAAAGGGAGAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107156608_1107156613 26 Left 1107156608 13:37174514-37174536 CCTAGTCTCTCCCTTTTCATTCT No data
Right 1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107156608 Original CRISPR AGAATGAAAAGGGAGAGACT AGG (reversed) Intergenic
No off target data available for this crispr