ID: 1107156609

View in Genome Browser
Species Human (GRCh38)
Location 13:37174524-37174546
Sequence AGATAGAGAGAGAATGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107156609_1107156614 25 Left 1107156609 13:37174524-37174546 CCCTTTTCATTCTCTCTCTATCT No data
Right 1107156614 13:37174572-37174594 TACCACCTTCAAGGTGATGATGG No data
1107156609_1107156613 16 Left 1107156609 13:37174524-37174546 CCCTTTTCATTCTCTCTCTATCT No data
Right 1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107156609 Original CRISPR AGATAGAGAGAGAATGAAAA GGG (reversed) Intergenic
No off target data available for this crispr