ID: 1107156610

View in Genome Browser
Species Human (GRCh38)
Location 13:37174525-37174547
Sequence TAGATAGAGAGAGAATGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107156610_1107156613 15 Left 1107156610 13:37174525-37174547 CCTTTTCATTCTCTCTCTATCTA No data
Right 1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG No data
1107156610_1107156614 24 Left 1107156610 13:37174525-37174547 CCTTTTCATTCTCTCTCTATCTA No data
Right 1107156614 13:37174572-37174594 TACCACCTTCAAGGTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107156610 Original CRISPR TAGATAGAGAGAGAATGAAA AGG (reversed) Intergenic
No off target data available for this crispr