ID: 1107156610 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:37174525-37174547 |
Sequence | TAGATAGAGAGAGAATGAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1107156610_1107156614 | 24 | Left | 1107156610 | 13:37174525-37174547 | CCTTTTCATTCTCTCTCTATCTA | No data | ||
Right | 1107156614 | 13:37174572-37174594 | TACCACCTTCAAGGTGATGATGG | No data | ||||
1107156610_1107156613 | 15 | Left | 1107156610 | 13:37174525-37174547 | CCTTTTCATTCTCTCTCTATCTA | No data | ||
Right | 1107156613 | 13:37174563-37174585 | TTTCTATTTTACCACCTTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1107156610 | Original CRISPR | TAGATAGAGAGAGAATGAAA AGG (reversed) | Intergenic | ||